ID: 992499488

View in Genome Browser
Species Human (GRCh38)
Location 5:77327860-77327882
Sequence CTGTGTGGGGGGAAGGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 354}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992499488_992499499 4 Left 992499488 5:77327860-77327882 CCGGGAGCCTTCCCCCCACACAG 0: 1
1: 0
2: 1
3: 28
4: 354
Right 992499499 5:77327887-77327909 AGGGCTCAAGGAACAGGACATGG 0: 1
1: 0
2: 2
3: 34
4: 379
992499488_992499497 -8 Left 992499488 5:77327860-77327882 CCGGGAGCCTTCCCCCCACACAG 0: 1
1: 0
2: 1
3: 28
4: 354
Right 992499497 5:77327875-77327897 CCACACAGTGTGAGGGCTCAAGG 0: 1
1: 0
2: 1
3: 21
4: 210
992499488_992499501 28 Left 992499488 5:77327860-77327882 CCGGGAGCCTTCCCCCCACACAG 0: 1
1: 0
2: 1
3: 28
4: 354
Right 992499501 5:77327911-77327933 GAAGGTACATTTTTTGAGAAAGG No data
992499488_992499500 10 Left 992499488 5:77327860-77327882 CCGGGAGCCTTCCCCCCACACAG 0: 1
1: 0
2: 1
3: 28
4: 354
Right 992499500 5:77327893-77327915 CAAGGAACAGGACATGGAGAAGG 0: 1
1: 0
2: 7
3: 46
4: 508
992499488_992499498 -2 Left 992499488 5:77327860-77327882 CCGGGAGCCTTCCCCCCACACAG 0: 1
1: 0
2: 1
3: 28
4: 354
Right 992499498 5:77327881-77327903 AGTGTGAGGGCTCAAGGAACAGG 0: 1
1: 0
2: 2
3: 6
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992499488 Original CRISPR CTGTGTGGGGGGAAGGCTCC CGG (reversed) Intronic
900241907 1:1621240-1621262 CTGGGTGGTGGGTGGGCTCCTGG + Intronic
900605602 1:3522332-3522354 CTGTGTGAGTGGTGGGCTCCCGG - Intronic
901019537 1:6248896-6248918 CAGTGTGGGTGGAAAGCCCCTGG + Exonic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901405164 1:9040276-9040298 CTGAGTGGGGTGCAGGCTCCAGG + Intronic
901562538 1:10084112-10084134 CTGTGTGGGGAGAGTGCTACTGG - Intronic
902597440 1:17519232-17519254 CTGTGTAGGGAAAGGGCTCCTGG - Intergenic
902862734 1:19257726-19257748 CTGTGATGGGGGAAGGCCCAGGG + Intronic
902890607 1:19440603-19440625 CAGTGTGGGGGGAAGGGACTTGG + Intronic
902993854 1:20208721-20208743 CTGTCTGGGGTAAAGACTCCTGG + Intergenic
903325057 1:22564534-22564556 CTGTGTGGGAGGAAGGATTGGGG + Intronic
903652632 1:24930785-24930807 CCGTGTGGGGTGGAGGCTCTTGG - Intronic
904130841 1:28274047-28274069 CTGGGTGTGGAGAGGGCTCCAGG - Exonic
904367907 1:30028388-30028410 CTGTGTGGTGGGAAGGTCACTGG - Intergenic
905209287 1:36362340-36362362 CAGTGTGGGTGCAGGGCTCCGGG + Intronic
906033957 1:42739647-42739669 CTGTGGGAGGGGAGGGCTCTAGG - Intronic
906804125 1:48763557-48763579 ATGTGTTGGGGCAAAGCTCCTGG + Intronic
907102791 1:51852005-51852027 CTGTGAGGGGGGCAGCCTACAGG + Intronic
909433693 1:75616577-75616599 CTGTGGAGGAGGACGGCTCCTGG - Intergenic
910468268 1:87523608-87523630 CTGTGTGTGGGGAATTTTCCTGG + Intergenic
910504114 1:87929631-87929653 TTGAGAGGGGGAAAGGCTCCAGG + Intergenic
912977808 1:114346101-114346123 GTCTCTCGGGGGAAGGCTCCTGG - Intergenic
913586075 1:120277111-120277133 GTGTTTCGGGGGAAGGCTCATGG + Intergenic
914568084 1:148888969-148888991 GTGTTTCGGGGGAAGGCTCATGG + Intronic
914604740 1:149241279-149241301 GTGTTTCGGGGGAAGGCTCATGG - Intergenic
914913583 1:151804915-151804937 CTGTGTGGGGAGAGGGTTCCTGG + Intronic
915581396 1:156815185-156815207 CTGTGTTGGAGGCAGCCTCCGGG + Exonic
915981707 1:160424453-160424475 CTGTGTGGGGTGAAGTCTTTAGG + Intronic
916485531 1:165255048-165255070 CTCTCTGTGGGGAAGGCTCTGGG + Intronic
917173243 1:172201452-172201474 CTCTTTGGGGTGAAGGCCCCAGG - Intronic
918180711 1:182084314-182084336 CAGTGTGGGGAGAGGACTCCAGG - Intergenic
919772758 1:201173176-201173198 CTGAGAGGGGGGAATTCTCCAGG - Intergenic
920232627 1:204480679-204480701 CTGTGTGGGTGGTGGGCTGCCGG + Intronic
920294283 1:204946470-204946492 ATGTGTGTGGGGCATGCTCCGGG - Intronic
920689056 1:208131864-208131886 CTGTGTGGCTGCAAAGCTCCTGG - Intronic
921593547 1:217030442-217030464 CAGTGTGGTGGGAAGGCCACTGG + Intronic
924579902 1:245314601-245314623 CTGGGTGAGGGGACGTCTCCTGG + Intronic
1063020477 10:2122152-2122174 CTGTGTGGTGTGAAGGCTGCTGG - Intergenic
1065500983 10:26382096-26382118 CAGTGTTGGGGGAAGGGACCTGG + Intergenic
1065787383 10:29229400-29229422 CTGTCTGGGGAGCAGGCTCTGGG + Intergenic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1068962085 10:62877143-62877165 CAGTGTGGGGGTTAGGATCCAGG + Intronic
1069598765 10:69689616-69689638 CTTTGTGGGGCGAATGCTTCAGG + Intronic
1069613197 10:69789163-69789185 CTCTGTGTGGGGAAGGCTGTGGG + Intergenic
1069904309 10:71723532-71723554 TTGTGTGGGAGGAGGGCTCCTGG + Intronic
1070325770 10:75387967-75387989 CTATGTGGGAGGAGGGGTCCAGG + Intergenic
1070401063 10:76053961-76053983 CTGTGTGTTGGGAAGTCTCCAGG + Intronic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1071229918 10:83573605-83573627 CTGTGTGATGGGAAGGCACCTGG - Intergenic
1071493036 10:86149295-86149317 CTGTCTGAGCAGAAGGCTCCTGG - Intronic
1071571399 10:86699415-86699437 CTGTGTGGGGGTAAGGATGGAGG - Intronic
1072617638 10:97060102-97060124 CTGTAGGGTGAGAAGGCTCCAGG + Exonic
1073415025 10:103373881-103373903 CTCTCTGGTGGGAAGGATCCTGG + Intronic
1074165748 10:110872293-110872315 CTCAGTGGGGAGATGGCTCCGGG - Intronic
1074751732 10:116593440-116593462 ATGTGTGGAAGGCAGGCTCCTGG - Intronic
1074865939 10:117544262-117544284 CCGTGCGGGAGGAAAGCTCCAGG + Intronic
1075396818 10:122133692-122133714 CAGCGTGGGGAGAAGGCTTCTGG - Intronic
1076533724 10:131162299-131162321 CAGTGTCGGTGGCAGGCTCCTGG - Intronic
1076817102 10:132920402-132920424 CTCTGAGTGGGGGAGGCTCCAGG + Intronic
1077394617 11:2314963-2314985 CTGTCTAGGGGGAAGGGTGCAGG + Intronic
1079035255 11:17014628-17014650 CTGGGGGCGGGGAAGGCTCGGGG - Intergenic
1079364383 11:19796653-19796675 CTCTGTGGAGGGAAGGCTGGTGG + Intronic
1079898271 11:26149324-26149346 CAGTGTAGCTGGAAGGCTCCTGG - Intergenic
1081287126 11:41284615-41284637 CTGTCTGTGGGGAGGGCTGCTGG - Intronic
1081796483 11:45824031-45824053 GTGTGTGGGAGGAGGGCTCCCGG - Intergenic
1084128919 11:67118874-67118896 GTGTGTGGGGGGAGGGCGCGCGG + Intergenic
1085510514 11:77085816-77085838 CTGGGTGGAGGGGAGGCTGCAGG + Intronic
1087607546 11:100394929-100394951 AAGGTTGGGGGGAAGGCTCCAGG - Intergenic
1089202310 11:116731852-116731874 CTGTGAAGGGGAAGGGCTCCTGG - Intergenic
1089205976 11:116763090-116763112 CTCTGAGGGGAGAAGGATCCGGG + Exonic
1089237398 11:117042582-117042604 CAGTGTGGAGGAAAGACTCCTGG - Intronic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1089601212 11:119616514-119616536 CTGTGGGGAGGGCAGGCTCAAGG + Intergenic
1089681674 11:120122193-120122215 CTGGGGAGGGGGAAGCCTCCGGG - Intronic
1091004153 11:131937396-131937418 TTGTGTGGGTGGAAGTCTCTGGG + Intronic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091345186 11:134847585-134847607 ATGTGTGAGGGGAGGGGTCCCGG + Intergenic
1091347416 11:134864579-134864601 CTGTGGTTGGGGAAGGTTCCAGG + Intergenic
1091449075 12:561588-561610 CTCTGTGAGGGGACAGCTCCAGG - Exonic
1091564130 12:1635584-1635606 CTGTGTAGAGGGAAAGCTTCCGG + Intronic
1091981751 12:4870000-4870022 CTCTGTGCAGAGAAGGCTCCAGG - Intergenic
1092242439 12:6843503-6843525 CTGTGTGAGCAGAAAGCTCCCGG - Exonic
1092405877 12:8221937-8221959 CTCTGAGCGAGGAAGGCTCCCGG + Exonic
1092849278 12:12612115-12612137 CTGAGCCGGGGGAGGGCTCCGGG + Exonic
1093748658 12:22772830-22772852 CTGGGTTGAGTGAAGGCTCCAGG - Intergenic
1093749636 12:22783083-22783105 CTGGGTGGGGTGGAGGCTGCAGG + Intergenic
1095386042 12:41651071-41651093 CTGGGTTGGGAGAGGGCTCCTGG + Intergenic
1096195020 12:49644220-49644242 CTGTGTGAGGCCATGGCTCCTGG + Exonic
1097235341 12:57535708-57535730 CTGGGTGGGGGGAAGACTGGAGG - Intronic
1101072281 12:101088240-101088262 CTGTGGGAGGAAAAGGCTCCAGG - Intronic
1102290141 12:111692674-111692696 CTGTGTGGGAAGAAGGCACAGGG - Intronic
1102654115 12:114465987-114466009 GTGTGTGGAGGGGAGGCACCTGG - Intergenic
1103656411 12:122474661-122474683 CTGAGTGGGTGGAAGGCTAATGG + Intronic
1103911632 12:124355334-124355356 CTGAGTGGGGGCCAGGCTCTCGG - Intronic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1104666592 12:130651526-130651548 CTGTGCCGTGGGCAGGCTCCAGG - Intronic
1104984282 12:132587794-132587816 CTCTGTGGGGGGTACACTCCTGG + Intergenic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105946967 13:25198392-25198414 CTGGGTGGGTGGGAGGCTCACGG + Intergenic
1106343288 13:28851896-28851918 CTGTGTGGAGAGTAGACTCCAGG - Intronic
1106403276 13:29450142-29450164 CTCTCTGGGGGGAAGTGTCCAGG + Intronic
1106998660 13:35518826-35518848 CGGTGTGGGGGGAAGGTTGCAGG + Intronic
1107302829 13:38984009-38984031 CTGTGGGGGGGGATGCCTCCAGG - Intronic
1108176236 13:47795630-47795652 CTGGGTTGGGGGCAGACTCCTGG + Intergenic
1108598177 13:51967935-51967957 CAGTCTGAGGGGAATGCTCCAGG - Intronic
1110247491 13:73342856-73342878 GTGTGTGGGGGGATGGTTTCAGG - Intergenic
1111349079 13:87002342-87002364 CTGAGTGGTGGGTAGGCTCAAGG + Intergenic
1111756475 13:92402553-92402575 CTGTGTTGGGGGATGGTTTCAGG + Intronic
1112462915 13:99618706-99618728 CTGGGTGGGGGGAAGGGAACAGG - Intronic
1113082839 13:106535577-106535599 TTGTGTGCGGGGAGGGCGCCGGG + Intergenic
1113222788 13:108124345-108124367 CAGTGTGAGGGGAAGGCTGGTGG - Intergenic
1113851286 13:113419910-113419932 GTGTGTGTGGAGGAGGCTCCTGG + Intergenic
1115738693 14:36363994-36364016 CTGTGGGGGCTGTAGGCTCCTGG + Intergenic
1116948774 14:50859683-50859705 CTGTGCGAGGGGAAAGCTCCGGG + Intronic
1118743273 14:68756581-68756603 CTGACTGGGAGGAAGGCTCCAGG - Intergenic
1119263419 14:73251287-73251309 CAGGGTGGCGGGAAGGCTCAGGG - Intronic
1122269868 14:100564075-100564097 CTGTCTGTGGGGAAGGGTCTCGG + Intronic
1122269888 14:100564132-100564154 CTGTCTGTGGGGAAGGGTCTCGG + Intronic
1122968663 14:105143687-105143709 CAGTGTTGGGGGCAGGCTGCTGG - Intronic
1123425257 15:20165498-20165520 CTGGGTGGGGTGGAGACTCCAGG + Intergenic
1123534481 15:21172032-21172054 CTGGGTGGGGTGGAGACTCCAGG + Intergenic
1124142347 15:27088454-27088476 CTGTGTGCCGGGCAGGCTGCGGG + Intronic
1124250038 15:28101064-28101086 CTGAGTGGGCAGAAGGCTCTTGG + Intergenic
1125574719 15:40747381-40747403 CTGTGAGGCAGGGAGGCTCCAGG + Intronic
1127775053 15:62257978-62258000 CTGGGAGGTGGGAAGGCTGCAGG - Intergenic
1128511809 15:68318167-68318189 CTGTGAAGGAGGTAGGCTCCAGG + Intronic
1128874342 15:71189960-71189982 CTGCTGGGGTGGAAGGCTCCTGG + Intronic
1131049550 15:89337428-89337450 CTCTGTGGGGGGAGAGGTCCAGG - Intergenic
1131414888 15:92246136-92246158 ATTTGTGGGGATAAGGCTCCTGG + Intergenic
1133008244 16:2896500-2896522 CTGGCTTGGGGGATGGCTCCTGG - Exonic
1133013807 16:2929736-2929758 CTGGCTTGGGGGATGGCTCCTGG - Exonic
1133370326 16:5241193-5241215 CTGTGTGGGAGGCTTGCTCCTGG + Intergenic
1136110698 16:28062571-28062593 CGATGGGGGTGGAAGGCTCCCGG + Intronic
1136859601 16:33690245-33690267 CTGGGTGGGGTGGAGACTCCAGG - Intergenic
1137559439 16:49493322-49493344 CTGTGTGGGAGGTGGGCTGCAGG - Intronic
1137586078 16:49664633-49664655 CAGGGTGGGGGGACGGCCCCTGG + Intronic
1138223377 16:55272031-55272053 CTGTGTGGGGGATAGGCTGCAGG + Intergenic
1140440664 16:74985080-74985102 CTGTGTGGGGCGCACGGTCCCGG - Exonic
1140804485 16:78520578-78520600 TTGTCTGGTGGGAAGGCTGCTGG + Intronic
1142229142 16:88891495-88891517 CAGTGTGGGGGCAAGGCTCGGGG - Intronic
1203121107 16_KI270728v1_random:1538424-1538446 CTGGGTGGGGTGGAGACTCCAGG - Intergenic
1142474433 17:180901-180923 CTGGGTCGGGGGAGGGCTCGAGG + Intronic
1143416188 17:6752565-6752587 CTGTGTTTGGGGAAGACTCTAGG - Intergenic
1143520773 17:7443086-7443108 CACTGTGGAGAGAAGGCTCCTGG - Exonic
1145065370 17:19758054-19758076 CTGTGTGTGAGGGAGGCTCCAGG + Intergenic
1145913539 17:28556697-28556719 CTGTGGGAGGGGCAGGCACCAGG - Intronic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146970424 17:37067605-37067627 CTGCCTGGAGGGAAGGTTCCGGG - Intergenic
1147169065 17:38607506-38607528 CTCTGTGTGGGGGAGGCTCAGGG + Intergenic
1147219475 17:38919994-38920016 CAGTGAGAGGGGAGGGCTCCTGG + Exonic
1148331143 17:46814703-46814725 CTGCGGGGGAGGAAGGCCCCAGG - Intronic
1149610010 17:57953281-57953303 CTGTGTGGTGGGAAGGCCCTGGG - Intronic
1149681175 17:58508362-58508384 CTGAGAGGGAGGAAGGCTCATGG - Intronic
1151923195 17:77173361-77173383 GTGAGTCGGGGGAAGGGTCCAGG + Intronic
1152123869 17:78434893-78434915 CTGTGTGGGGGGAGGGCTTCAGG + Intronic
1152128641 17:78462458-78462480 CGGTGTGGAGGAAAGGATCCAGG + Intronic
1152267659 17:79305634-79305656 CTGTGTGGGAGGAAGACGCAGGG - Intronic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160523528 18:79522405-79522427 CTGGGTGGGGGGACGTCTGCTGG + Intronic
1160722603 19:604105-604127 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1160722620 19:604146-604168 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1160722632 19:604187-604209 CTGAGTGGGGTCAAGGCCCCAGG + Intronic
1160722646 19:604228-604250 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1160722663 19:604269-604291 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1160722677 19:604310-604332 CTGGGTGGGGTCAAGGCCCCAGG + Intronic
1161770067 19:6226206-6226228 ATGTGTGGGTGGCAGGCACCGGG + Intronic
1162376751 19:10309573-10309595 CTGTGTGGTGGGAGCGCTCTTGG + Exonic
1162392851 19:10400006-10400028 CAGGGTGGTGGGCAGGCTCCAGG - Intronic
1162791622 19:13065975-13065997 CTGTGTGGCTGGAAGGCTTCTGG + Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1164903335 19:31946820-31946842 CTGTGTGGTGAGAAAACTCCTGG + Intergenic
1165111298 19:33503944-33503966 CTGTGCGGAGGGAAGCCACCAGG + Intronic
1166270018 19:41708023-41708045 CTGTCCTTGGGGAAGGCTCCAGG - Intronic
1166301181 19:41913008-41913030 CTGGGAGAGGGGAAGGCCCCGGG - Intronic
1166836679 19:45671410-45671432 TTGTGTCTGGGGAGGGCTCCGGG - Intronic
1166960066 19:46491929-46491951 CTGTGGGTGGGGAGGGCCCCAGG - Exonic
1167254364 19:48418486-48418508 CTGTGTGGGGGATAGGCTGTAGG + Intronic
1167619893 19:50554941-50554963 GTGTGTGGGGGGCAGGGTGCAGG + Intronic
1167735827 19:51294032-51294054 CTGTGTGGGGCGAGGGGGCCTGG - Intergenic
1168543555 19:57231856-57231878 GTGTGTGGGGTGCTGGCTCCTGG + Intronic
925082875 2:1083625-1083647 CTGTGTGGGCGGAAGCCACCAGG + Exonic
925197929 2:1942321-1942343 CTGTGTGTTGGGAATGTTCCCGG - Intronic
925998548 2:9311742-9311764 CTGAGTGGCGGGCAGGCTCTGGG - Intronic
926063547 2:9820010-9820032 CTGTGTGAAGAGCAGGCTCCAGG - Intergenic
926541167 2:14182847-14182869 GTGAGTGGAGGGAGGGCTCCAGG - Intergenic
927083909 2:19655691-19655713 GTGTGAGGGGGGAAGGCTACTGG - Intergenic
928158083 2:28894750-28894772 CTGTGCGGGGAGAAGGCGCAAGG - Exonic
928172226 2:29011178-29011200 CTGTGTGGGTGTCAGCCTCCTGG + Intronic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
931247391 2:60503000-60503022 CTGTCTAGGGGGATGGCTACTGG + Intronic
932422967 2:71612249-71612271 GTGTGTGGGGGGAAGAATCTGGG + Intronic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934457963 2:94191355-94191377 CTGGGTGGGGTGGAGACTCCAGG - Intergenic
934892993 2:98087074-98087096 CTGTGGGCGGGGCCGGCTCCAGG + Intergenic
935193163 2:100794307-100794329 CTTTGTGGGGGGACTGCCCCTGG - Intergenic
935846959 2:107176250-107176272 GTGTGTGGCTGGAAGGCACCAGG - Intergenic
937083533 2:119156857-119156879 CTGGATGGCGGGAAGGCTCACGG - Exonic
937256120 2:120557064-120557086 CACTGTGGGGAGAAGACTCCAGG + Intergenic
937914716 2:127093152-127093174 CCTTGTGGGGGCCAGGCTCCAGG - Intronic
938276908 2:130034731-130034753 CTATGTGTGGGGAAGTTTCCTGG - Intergenic
938327875 2:130425510-130425532 CTATGTGTGGGGAAGTTTCCTGG - Intergenic
938341066 2:130536893-130536915 ATGTTTGGGCTGAAGGCTCCGGG - Intergenic
938348764 2:130583816-130583838 ATGTTTGGGCTGAAGGCTCCGGG + Intronic
938362073 2:130695974-130695996 CTATGTGTGGGGAAGTTTCCTGG + Intergenic
938438478 2:131302661-131302683 CTATGTGTGGGGAAGCTTCCTGG + Intronic
941044969 2:160664583-160664605 TTGGGTGGTGGGAAGGCTCAAGG + Intergenic
941753001 2:169152927-169152949 CTGTGCGAGGGGAGGGCTCTAGG - Exonic
944939143 2:204604373-204604395 CTGTGTGGTGGTAAGTGTCCTGG + Intronic
948254085 2:236553250-236553272 CTGTCTGCCTGGAAGGCTCCTGG - Intergenic
948662116 2:239514128-239514150 CTGTGTTGGGGGATGGCCCTCGG - Intergenic
948793545 2:240391141-240391163 GTGCGTGGGGCGAAGGCTCTTGG - Intergenic
948813684 2:240499081-240499103 CTGTGTGCTGGGAAGGCACCTGG + Intronic
948936180 2:241166468-241166490 CTGTGTGGGCGGTGGGCACCAGG + Intronic
1169072145 20:2739192-2739214 CTGGGTGATGGGAAGGCTACAGG - Intronic
1169935375 20:10877901-10877923 CTGTTTGGGGGAAAGGCTGGAGG + Intergenic
1169956431 20:11108192-11108214 CTGGGTGGGGGGTAGGTTCTGGG + Intergenic
1170504860 20:17014487-17014509 CGGTGGGTGGGGGAGGCTCCAGG + Intergenic
1170613708 20:17933335-17933357 TTTTGTGGGGGGATGGCCCCAGG + Intergenic
1172122730 20:32608243-32608265 CTGCGTGGCGTGAAGGCCCCTGG + Intronic
1172604573 20:36206105-36206127 CAGTGGGGGAGGAAGGCCCCTGG + Intronic
1174074716 20:47925399-47925421 CTGTGTGTGGGGCAGGCTGGAGG + Intergenic
1175762457 20:61570933-61570955 CTGTGTGGGTGCAGGGCTGCAGG + Intronic
1175878606 20:62243502-62243524 CTGTCAGGGTAGAAGGCTCCTGG + Intronic
1175917468 20:62433360-62433382 ATGTGTGGGGTGGAGGCTCCGGG + Intergenic
1175922672 20:62457432-62457454 CTGTGTGTGGGGAGGGTCCCCGG - Intergenic
1175938139 20:62524568-62524590 CTGTGTTGGGGGAGGGTCCCAGG + Intergenic
1176214353 20:63941252-63941274 CTGTGGGGAGGGAGGGCTCTGGG - Intronic
1176342857 21:5714382-5714404 CTGTGATGGGGAAGGGCTCCAGG - Intergenic
1176475111 21:7146533-7146555 CTGTGATGGGGAAGGGCTCCAGG - Intergenic
1176501970 21:7610074-7610096 CTGTGATGGGGAAGGGCTCCAGG + Intergenic
1176537178 21:8112451-8112473 CTGTGATGGGGAAGGGCTCCAGG - Intergenic
1176623854 21:9075102-9075124 CTGGGTTGGGGTAAGTCTCCCGG - Intergenic
1179802496 21:43817481-43817503 CTATGTGGGAGGAGGGCGCCAGG - Intergenic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181307910 22:21927401-21927423 CTGTGAGCGTGGGAGGCTCCAGG + Intronic
1181358249 22:22315073-22315095 CTGGGTGGGGTGGAGACTCCAGG + Intergenic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182241079 22:28916952-28916974 CTGTGTGGGGCCAGGGTTCCAGG - Intronic
1182361373 22:29748385-29748407 CTGGCTGGGGGCCAGGCTCCTGG - Intronic
1182760748 22:32720702-32720724 CTGTGGGGTGGGAAGGCCACGGG - Intronic
1182821425 22:33219923-33219945 CTGTGTGAGGGGAGGATTCCAGG - Intronic
1183014316 22:34973341-34973363 CTGTGTGTGGAGGAGGCCCCAGG + Intergenic
1183360711 22:37381767-37381789 CTGTGTGGAGTGAGAGCTCCAGG + Intronic
1183396912 22:37576905-37576927 TTGGGTGGGGACAAGGCTCCCGG - Intronic
1184252892 22:43270974-43270996 CTGGGTGAGGGGCAGCCTCCCGG + Intronic
1185129316 22:49028630-49028652 CTGTCTGGGGGGCAGGCACCTGG + Intergenic
1185223835 22:49642173-49642195 CTATCTGGGGGGAAGGTGCCAGG - Intronic
1185419985 22:50729815-50729837 CTGTGTCAGGGGAAGCCTCAAGG - Intergenic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203242124 22_KI270733v1_random:28855-28877 CTGTGATGGGGAAGGGCTCCAGG - Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
952426109 3:33175749-33175771 CTGTGTGCGTGGAAGGGTCGGGG - Intronic
953386050 3:42506166-42506188 CATTTTGGGGGTAAGGCTCCAGG + Intronic
953421105 3:42753936-42753958 CTGTGTGGAAGGCAGGCACCGGG + Intronic
953559301 3:43972174-43972196 CAGTGAGAGGGGAGGGCTCCTGG - Intergenic
954114642 3:48459634-48459656 CTGTGGGTGCGGAAGGCTCTGGG - Intronic
954298579 3:49687312-49687334 GTGTGCTGGGGGAAGGCCCCAGG + Intronic
954436498 3:50499050-50499072 CTGTGGTGGGGGACGTCTCCAGG - Intronic
955873059 3:63460297-63460319 CTCTGTGGGAGGATGGATCCTGG - Intronic
959653652 3:108776372-108776394 CAGTGGGGGGAGAAGGATCCAGG + Intergenic
959685168 3:109137580-109137602 CTGTGTGTGGGAAGGGCTTCAGG - Intergenic
961762658 3:129183360-129183382 GTGTGGTGGGGAAAGGCTCCCGG - Intronic
962259102 3:133891987-133892009 GTGTGTGGTGGGAAGGGTCAGGG - Intronic
963786434 3:149539398-149539420 CTGTCTGGGAGCAAGGCCCCAGG - Intronic
967227981 3:187311793-187311815 CGGTGTGGGGGGAATGTTCCTGG - Intergenic
968672093 4:1857165-1857187 CTGGGCTGGGGGGAGGCTCCTGG - Intergenic
968698408 4:2043487-2043509 GTGAGTGGGGAGAGGGCTCCAGG - Intronic
969760253 4:9176030-9176052 CTCTGAGCGAGGAAGGCTCCCGG - Exonic
969870872 4:10103870-10103892 CTGTATGGGGGCAAGGCTCGTGG - Intronic
970210326 4:13703280-13703302 CAGTGTGTGGGGAAGGCTGGTGG - Intergenic
973588908 4:52420524-52420546 CTGGGTGAGGGGCAGCCTCCAGG + Intergenic
975624268 4:76328271-76328293 CTATGTGCCAGGAAGGCTCCAGG + Intronic
976267422 4:83197179-83197201 CTGTGTGGGGAGAAGCCTCTGGG + Intergenic
977562447 4:98546336-98546358 CTGTGTTGAGGGATGGCTCAGGG - Intronic
978583700 4:110256578-110256600 CTGTGTCTGGGGAGGGCTGCAGG + Intergenic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
981172909 4:141645564-141645586 CTGAGTGGTGGGAAGACACCTGG - Intronic
984961245 4:185100433-185100455 TTGTGTGGGGACAATGCTCCTGG - Intergenic
991096704 5:62747545-62747567 CTGTGTGGCAGGCAGGCACCAGG - Intergenic
992008066 5:72499195-72499217 CTGGCTGGGGAGAAGTCTCCAGG - Intronic
992484269 5:77180386-77180408 CTGTGCGGGGCTAAGGCGCCAGG + Intergenic
992499488 5:77327860-77327882 CTGTGTGGGGGGAAGGCTCCCGG - Intronic
992877843 5:81075486-81075508 CTCCGATGGGGGAAGGCTCCAGG - Intronic
994334155 5:98544790-98544812 GTGTGTGGGGGGTAGGCTGGGGG - Intergenic
995681810 5:114728717-114728739 CTGGGTGGGATGATGGCTCCAGG + Intergenic
997656562 5:135559502-135559524 ATGTGCTGGGGGAAGGATCCTGG + Intergenic
998952422 5:147405453-147405475 CTGTGTGGATGGGAGGATCCTGG - Intronic
999276423 5:150333685-150333707 CTGTGTGGGGTGAAGGGAGCAGG - Intronic
1000097533 5:157985026-157985048 CTGTTTGTGGAGAGGGCTCCAGG + Intergenic
1000602362 5:163289816-163289838 CTGGGTGGAGGGAAGGCTTCTGG + Intergenic
1000883909 5:166728752-166728774 GTGTGTTGGGGGAATGCTACTGG + Intergenic
1002603792 5:180370289-180370311 CTGGGTGGGCGGGAGGCTTCAGG + Intergenic
1004698674 6:18058097-18058119 GTGTGATGGAGGAAGGCTCCTGG - Intergenic
1005496000 6:26388379-26388401 CAGTGTGGGTGGAATGGTCCTGG + Intronic
1005664796 6:28041618-28041640 TTGTGTGATGGGAAGGATCCTGG + Intergenic
1006096682 6:31660684-31660706 CTGTGCGCGGGGACCGCTCCCGG + Exonic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007686402 6:43669739-43669761 CAGTGTGGGAGGAAGGAGCCTGG - Intronic
1012007777 6:93736043-93736065 CAGTGTTTGGGGAAGTCTCCAGG - Intergenic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1015017174 6:128427724-128427746 CTATGTGGAGGGAGGGCTTCAGG - Intronic
1015121793 6:129708304-129708326 CTGTGTGGGGCCACAGCTCCAGG - Intronic
1017616765 6:156254295-156254317 CTGTGTCAGGGGCAGGCTGCAGG - Intergenic
1018468789 6:164078707-164078729 CTGTCTCAGGGGAAGGCTGCTGG + Intergenic
1019167503 6:170108448-170108470 CCATGTGAGGGGAAGGGTCCTGG - Intergenic
1019378946 7:711704-711726 CTGTGGGGAGGGAAGGCTCTGGG - Intronic
1019801499 7:3091459-3091481 CTGGGTGGTGGGAGGGCTGCTGG + Intergenic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1023079551 7:36514350-36514372 CTGGGTGGGGGGTGGGATCCTGG + Intronic
1023601576 7:41886300-41886322 CTCTGTGGGGGCCAGGATCCAGG - Intergenic
1024017381 7:45329343-45329365 CTGGGGGTGGGGAATGCTCCTGG + Intergenic
1024527254 7:50359406-50359428 CTCTGTGGGCAGAAGGCTGCAGG - Intronic
1029737452 7:102472648-102472670 CTGAGTGGGGGCAGAGCTCCCGG - Intronic
1031452345 7:121937438-121937460 CTCTGGGTGGGGAAGGCCCCAGG - Intronic
1032785476 7:135196539-135196561 CTGTGTGGAGCAAAGTCTCCAGG - Intronic
1035058208 7:156050902-156050924 GTGGGTGAGGGGAGGGCTCCAGG - Intergenic
1035527583 8:325760-325782 CTGTGTGGGGGTGAGGCTGGAGG - Intergenic
1035601320 8:898543-898565 CTGTGTGCAGGGAAGGGGCCTGG + Intergenic
1036263877 8:7259777-7259799 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036265173 8:7267399-7267421 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036266474 8:7275021-7275043 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036267780 8:7282643-7282665 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036269083 8:7290265-7290287 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036270377 8:7297887-7297909 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036297508 8:7549168-7549190 CTCTGAGCGAGGAAGGCTCCCGG + Intergenic
1036298812 8:7556815-7556837 CTCTGAGCGAGGAAGGCTCCCGG + Intergenic
1036300117 8:7564465-7564487 CTCTGAGCGAGGAAGGCTCCCGG + Intergenic
1036301421 8:7572110-7572132 CTCTGAGCGAGGAAGGCTCCCGG + Intergenic
1036302718 8:7579759-7579781 CTCTGAGCGAGGAAGGCTCCCGG + Intergenic
1036315917 8:7718316-7718338 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036317224 8:7725964-7725986 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036318532 8:7733612-7733634 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036319841 8:7741259-7741281 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036321148 8:7748907-7748929 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036322457 8:7756555-7756577 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036325067 8:7771851-7771873 CTCTGAGCGAGGAAGGCTCCCGG - Intergenic
1036350977 8:8012457-8012479 CTCTGAGCGAGGAAGGCTCCCGG + Intergenic
1036353574 8:8027751-8027773 CTCTGAGCGAGGAAGGCTCCCGG + Intergenic
1036846261 8:12172876-12172898 CTCTGAGCGAGGAAGGCTCCCGG + Intergenic
1037027461 8:14056841-14056863 CTTTGTGAGGGCAAGGCACCTGG + Intergenic
1037522198 8:19691196-19691218 GAGTGTGGGGGTAATGCTCCAGG + Intronic
1037887494 8:22602492-22602514 CTGAGTGTGGGGAGGGCTCTGGG + Intronic
1038494259 8:27990467-27990489 CTGTGTTGGGGGTAGGCTGATGG + Intronic
1040620412 8:49085807-49085829 GTGTGTGGTGGCAAGGCTGCCGG - Intergenic
1041191957 8:55363784-55363806 CTGTGAGGGGTCTAGGCTCCAGG + Intronic
1044037129 8:87320614-87320636 GTGTGTGGGGGGGCGGCTCAGGG + Intronic
1044952956 8:97451435-97451457 CTGTGTTGTGGGAAGGTTACCGG - Intergenic
1046463059 8:114568075-114568097 CTGTGAGGGCTGAAGGCTCAGGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048292749 8:133192916-133192938 CAGGTTGGAGGGAAGGCTCCCGG + Intronic
1049234876 8:141507487-141507509 CTGTGTGGGTGGCAGGTCCCGGG + Intergenic
1049266088 8:141668597-141668619 ATGTGTGGGCAAAAGGCTCCAGG + Intergenic
1049401334 8:142428787-142428809 CTGTGTGGGGAGATGGCTGGGGG + Intergenic
1049688889 8:143950184-143950206 CTGTGGCTGGGGCAGGCTCCGGG + Exonic
1049770081 8:144375863-144375885 GTGTGTTGGGGGAAGGCCCTGGG + Intronic
1049997485 9:1046230-1046252 GGGTGTGGGGGGAATGCTCGGGG + Intergenic
1053428246 9:38025209-38025231 CTCTGTGGGAGGTGGGCTCCGGG + Intronic
1054275559 9:63063898-63063920 CTGGGTGGGGTGGAGACTCCAGG + Intergenic
1054299712 9:63368071-63368093 CTGGGTGGGGTGGAGACTCCAGG - Intergenic
1054399274 9:64701033-64701055 CTGGGTGGGGTGGAGACTCCAGG - Intergenic
1054432853 9:65185298-65185320 CTGGGTGGGGTGGAGACTCCAGG - Intergenic
1054497532 9:65836377-65836399 CTGGGTGGGGTGGAGACTCCAGG + Intergenic
1054730554 9:68698714-68698736 CTGTGTGGAGGGAAACTTCCAGG - Intergenic
1056815659 9:89799043-89799065 GTGTGAGGGAGGCAGGCTCCAGG + Intergenic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057243702 9:93435597-93435619 TTGTGTTGGGGGAGGGATCCAGG + Intergenic
1058966542 9:110044237-110044259 CTGTTTGGTGGGAAAGCCCCAGG + Intronic
1059574083 9:115471510-115471532 ATGTCTGGGGGCAAGGTTCCTGG - Intergenic
1060047764 9:120354103-120354125 CTGACTGTGGGGAAGGCTCTTGG - Intergenic
1061000312 9:127899073-127899095 CCGCGTGGGAGGAGGGCTCCAGG + Intronic
1061963946 9:134002934-134002956 CTGGGTGTGGGGTGGGCTCCTGG + Intergenic
1062214970 9:135384246-135384268 CTGGACGGGGGGAAGCCTCCTGG - Intergenic
1062586300 9:137251458-137251480 CAGTGTGGGGGGCAGGTTGCTGG + Intronic
1203747038 Un_GL000218v1:45530-45552 CTGGGTTGGGGTAAGTCTCCCGG - Intergenic
1203458446 Un_GL000220v1:11932-11954 CTGTGATGGGGAAGGGCTCCAGG - Intergenic
1190111241 X:47590397-47590419 CTTCGTGGGGAGAATGCTCCAGG - Intronic
1196625060 X:117868902-117868924 CTGTGTGGGAGGATGGGCCCGGG + Intergenic
1199941083 X:152628494-152628516 CCGTTTGGGGAGAAGGCTTCAGG - Intergenic
1200210787 X:154345819-154345841 CTGTGTGGGGGGCAGGCCCGAGG - Intergenic
1200220065 X:154386273-154386295 CTGTGTGGGGGGCAGGCCCGAGG + Intergenic
1201160366 Y:11160542-11160564 CTGGGTTGGGGTAAGTCTCCCGG - Intergenic