ID: 992499635

View in Genome Browser
Species Human (GRCh38)
Location 5:77329307-77329329
Sequence CATTATATGCCAAAAATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 377}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992499634_992499635 -3 Left 992499634 5:77329287-77329309 CCTCAGGGAGAAAGTTTACTCAT 0: 1
1: 0
2: 0
3: 18
4: 169
Right 992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG 0: 1
1: 0
2: 6
3: 26
4: 377
992499630_992499635 18 Left 992499630 5:77329266-77329288 CCTTTAGCACCTAGTCATACACC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG 0: 1
1: 0
2: 6
3: 26
4: 377
992499633_992499635 9 Left 992499633 5:77329275-77329297 CCTAGTCATACACCTCAGGGAGA 0: 1
1: 0
2: 2
3: 10
4: 127
Right 992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG 0: 1
1: 0
2: 6
3: 26
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992499635 Original CRISPR CATTATATGCCAAAAATGAA TGG Intronic
900857819 1:5200133-5200155 CATTGTAGGCTAAAAATGACTGG - Intergenic
904106172 1:28086603-28086625 CATTAAACCCCAAAAATGATGGG - Intronic
904816003 1:33199425-33199447 AAATATATTTCAAAAATGAAGGG + Intergenic
904982223 1:34515446-34515468 TTCTATATGCCAATAATGAATGG + Intergenic
906116702 1:43361754-43361776 GATTATATGCCATAAGTGATGGG - Intronic
908152658 1:61319347-61319369 CATTACATCTCAAGAATGAAAGG + Intronic
909089632 1:71209108-71209130 CATTTTATTCAAAGAATGAAGGG - Intergenic
909209055 1:72799279-72799301 TATTTTATGCAACAAATGAAGGG + Intergenic
909913488 1:81289566-81289588 CATTATAGACCAAACATGAGTGG + Intergenic
910683765 1:89894613-89894635 CATTATTTGGCTAAAGTGAATGG + Intronic
910914194 1:92271833-92271855 GATTATATGACAAAAGTGAAGGG + Intronic
911119136 1:94277650-94277672 CTTTATATGCTAAAATAGAATGG - Intergenic
911396504 1:97316856-97316878 CATTATAAGGCAGAAAGGAATGG - Intronic
911704725 1:100998204-100998226 AATTAGATGCCAAGAATAAAAGG + Intronic
911972308 1:104453698-104453720 CTTTATATGCCAATTGTGAATGG + Intergenic
913372893 1:118120466-118120488 TATTTTATGCCCAAACTGAAAGG + Intronic
916501332 1:165389987-165390009 CATTTTAGCCCAAAGATGAAGGG + Intergenic
916967523 1:169966033-169966055 CATTATAAGCCTAAAAAGTATGG + Intronic
916995585 1:170295075-170295097 CTTTATGTGCCAAAAAAGAAAGG + Intergenic
917333247 1:173904107-173904129 ATTTACCTGCCAAAAATGAACGG - Intronic
917473962 1:175352327-175352349 CATTTTATCCCCAAAATGCATGG - Intronic
918027666 1:180768336-180768358 CTTTATGTACCAAAAATAAATGG + Intronic
918360643 1:183753742-183753764 CTATATATGCCAAAAATTCAAGG - Intronic
918724974 1:187909466-187909488 AATCATATGGCAAAAATTAATGG + Intergenic
918777398 1:188651368-188651390 AATAATATGGCAAAAATTAAAGG - Intergenic
919463558 1:197906583-197906605 TATTATAAGCAAAAAATAAATGG + Intronic
919560810 1:199115952-199115974 TATGACATTCCAAAAATGAATGG + Intergenic
919821359 1:201474627-201474649 AATTAAATACCAAAAATAAATGG + Intergenic
920644673 1:207791897-207791919 CAATCTATGCCAAAGATAAAAGG - Intronic
921426580 1:215009010-215009032 GGTTATATACCAAAGATGAAAGG - Intronic
921427205 1:215017887-215017909 CATGAAATGCCAAAAATGGTGGG + Intronic
923180505 1:231513703-231513725 CAATATATGCATAAAAAGAAAGG - Intergenic
923358982 1:233188894-233188916 CATTATCTGGCAAACTTGAAGGG - Intronic
924254045 1:242164529-242164551 CACTATAAGCAAAAAAGGAAAGG + Intronic
1063083417 10:2790283-2790305 CATTTTATGTCATAAATGGAAGG - Intergenic
1063398142 10:5712595-5712617 GCTTATATACCAAAAATGATGGG - Intronic
1063709871 10:8467146-8467168 CACTATATGCGACAAGTGAATGG - Intergenic
1063772697 10:9222278-9222300 CATTGTATGGCAAAAGTGAAGGG + Intergenic
1064169022 10:13013320-13013342 CATTTTGTGCCAAAAAGAAAGGG + Intronic
1065368906 10:24962389-24962411 CTTTATATTCCAAACATTAAGGG - Intergenic
1066481976 10:35805334-35805356 TATTATTTGCCAGAAATCAATGG - Intergenic
1067011590 10:42719244-42719266 CTTTATATGCAAAAAAAAAAAGG - Intergenic
1068038401 10:51790345-51790367 CATTAAAAGACATAAATGAATGG + Intronic
1068335222 10:55626647-55626669 TATTGTTTGCCAAAAATCAAGGG + Intronic
1068923295 10:62508717-62508739 TATAATTTGCCAAAAATAAAGGG + Intronic
1068987753 10:63122909-63122931 CATTATATGGCAAAGATGAAGGG - Intergenic
1069336171 10:67353636-67353658 TCTTAGGTGCCAAAAATGAAAGG + Intronic
1070687657 10:78501194-78501216 CATTATGTGTTAAAATTGAAAGG + Intergenic
1071744607 10:88402247-88402269 CATTATAAGACAAAATAGAAAGG + Intronic
1071803891 10:89095251-89095273 CATTATCTGAGGAAAATGAAGGG + Intergenic
1072085415 10:92074447-92074469 CATTTAATGCTACAAATGAATGG + Intronic
1072359166 10:94642480-94642502 TATTATAGGCCAAATATAAAAGG - Intergenic
1073600467 10:104841485-104841507 CATTATGTGCCAAAGGTGACGGG - Intronic
1074332272 10:112526877-112526899 TATAAGATGCCAATAATGAAAGG - Intronic
1075436579 10:122448658-122448680 CATCATATGCCAAAGATGGAGGG - Intergenic
1077818615 11:5713435-5713457 CATTATGTGGCAAAAGTGATGGG - Intronic
1078164030 11:8867257-8867279 CATTATCTGCCGAGAATCAAAGG + Intronic
1079670127 11:23158811-23158833 CCTTATATGCCAAGAAAAAAAGG + Intergenic
1079826097 11:25195862-25195884 AAATACATGCCAAAAAGGAATGG - Intergenic
1080272519 11:30466144-30466166 TATTGAATGACAAAAATGAAAGG + Intronic
1081031167 11:38085322-38085344 CATTATATCCCCAAAATGGCTGG + Intergenic
1081079609 11:38725333-38725355 CATTATAATCCAGAAATGATGGG + Intergenic
1081835654 11:46151457-46151479 CATTATATGACAAATGTGAGAGG - Intergenic
1083189783 11:61041694-61041716 CATTATATAGCAAAAGTGGAAGG + Intergenic
1084894581 11:72256548-72256570 CAGAATATGGCAAAAATGACAGG - Intergenic
1085576335 11:77607163-77607185 CAATATATGACAAAATTCAATGG - Intronic
1085857601 11:80193113-80193135 CCTTACATGACAAAAATGTAAGG + Intergenic
1086216120 11:84383461-84383483 CATTAAATGGCAAAAAAGATGGG + Intronic
1087095674 11:94315085-94315107 CATTATGTGGCAAAAATAGAAGG - Intergenic
1087862950 11:103185897-103185919 CAGGATATGGCAGAAATGAAGGG + Intronic
1088458252 11:110055146-110055168 CATTATATACAAAAAAATAATGG + Intergenic
1088554509 11:111048206-111048228 CACAGTATGTCAAAAATGAAAGG + Intergenic
1090956825 11:131520676-131520698 CATTTCATGCCAACAATGACTGG - Intronic
1091472781 12:744309-744331 GATGATATTACAAAAATGAAAGG - Intergenic
1092443695 12:8533315-8533337 AATTTTATGCAATAAATGAATGG + Exonic
1093227168 12:16499108-16499130 GATTATATGTCAAAACTGGAGGG - Intronic
1094038474 12:26096760-26096782 CATTAAATGCCAAAGAAAAATGG - Intergenic
1094370408 12:29731426-29731448 AATTATATGCCCACAATGCACGG + Intronic
1095317759 12:40786485-40786507 CAGCAGAAGCCAAAAATGAAGGG - Intronic
1095327576 12:40915111-40915133 CATAATATACCTTAAATGAAAGG + Intronic
1095631746 12:44384842-44384864 TATTGTTTGCCAAAAATGTAGGG - Intronic
1096046161 12:48564212-48564234 CAATAAATGAAAAAAATGAATGG + Intergenic
1097046900 12:56193730-56193752 CATTTTATTCGAAAAATAAAAGG - Intergenic
1097579443 12:61436086-61436108 TATTACATAACAAAAATGAAAGG + Intergenic
1098177381 12:67806733-67806755 CATTATCTGCCAAGGAAGAATGG + Intergenic
1098395099 12:70008646-70008668 CCTTATAAGCCAAAAGAGAATGG + Intergenic
1098458067 12:70698988-70699010 CATTATATGCCTCAAGTGATTGG + Intronic
1099255084 12:80306241-80306263 CATTATAAGCCTATAAAGAAGGG + Intronic
1099432962 12:82609982-82610004 TATAATATCCCCAAAATGAAAGG - Intergenic
1099612617 12:84893603-84893625 TATTTTATTCCAGAAATGAAGGG - Intronic
1099700608 12:86077403-86077425 CATTACATGATAAAAAAGAAAGG + Intronic
1100921101 12:99487959-99487981 CATTAAAAGCCAAAACTGATAGG - Intronic
1101464843 12:104937971-104937993 CATTATCTACCAAAACTGAGAGG + Intronic
1101795138 12:107966120-107966142 CATTATGTGGCCAAGATGAAGGG - Intergenic
1101925542 12:108968459-108968481 CATTGAATCCCCAAAATGAAAGG - Intronic
1106352524 13:28946949-28946971 CATCATATACGAAATATGAAAGG - Intronic
1106756627 13:32828673-32828695 CCATCAATGCCAAAAATGAAAGG - Intergenic
1106992718 13:35441415-35441437 TACATTATGCCAAAAATGAATGG - Intronic
1107136118 13:36945695-36945717 AATTTAATGCCAGAAATGAATGG - Intergenic
1107327988 13:39265470-39265492 AAATATATGGCAAAAATGATGGG - Intergenic
1107923932 13:45239708-45239730 CATTATATGCCATAAAAATACGG - Intronic
1107967199 13:45608001-45608023 CAAAATATGCCATAATTGAAAGG - Intronic
1107996270 13:45864294-45864316 CTTGATATGTCAACAATGAAAGG + Intergenic
1110099865 13:71585229-71585251 TATTATATGCCAATTATGGAAGG + Intronic
1110611590 13:77494016-77494038 TGTTATATGGCAAAAGTGAAGGG - Intergenic
1110664855 13:78105119-78105141 CATTAAATGCCAGAAAACAATGG + Intergenic
1110726848 13:78835804-78835826 CTTTATATGTTAAAAATCAATGG + Intergenic
1111450538 13:88409184-88409206 CAGTATATGCCAGGAATCAATGG + Intergenic
1112127766 13:96487760-96487782 GATGATAAGCCAAATATGAATGG - Intronic
1112532533 13:100218713-100218735 CATTATATGGCAAAAGTGATGGG + Intronic
1112921420 13:104617096-104617118 CATTAGAAACCAAAAGTGAAAGG - Intergenic
1115427898 14:33282036-33282058 CTGTATATGCCACAAAAGAATGG + Intronic
1115791076 14:36879166-36879188 CTTTTTATTCCCAAAATGAATGG - Intronic
1116399764 14:44492127-44492149 CATTACATCCCAAAAATTGAAGG - Intergenic
1116609515 14:47049719-47049741 CATTCTATGCAGAATATGAAAGG - Intronic
1116758026 14:48972933-48972955 TAATATATGCCATAAATAAAAGG - Intergenic
1116893706 14:50294719-50294741 TAATATATTCCAAAAATAAAAGG - Intronic
1117163581 14:53012408-53012430 AATTATACACCAAAAATGAGTGG - Intergenic
1118794112 14:69124317-69124339 CAGTATATACCCAAATTGAAAGG - Intronic
1119331547 14:73798471-73798493 AATTATTTGCCACAAATGGAAGG - Intergenic
1120481090 14:85050358-85050380 CATTATATAGCAAAAATGAAAGG - Intergenic
1120794172 14:88613732-88613754 CATTTTATACATAAAATGAATGG + Exonic
1120896281 14:89535482-89535504 CATTATCTGCTAACCATGAATGG - Intronic
1121669904 14:95701069-95701091 AATTATATGATAAAGATGAAAGG + Intergenic
1124626976 15:31313354-31313376 AATCATATGCTAAAAATCAAAGG - Intergenic
1125463369 15:39927111-39927133 CATTATAGGCCATCAATAAAGGG + Intergenic
1126205897 15:46044391-46044413 AATTATATGGCATAAGTGAATGG - Intergenic
1126310301 15:47308310-47308332 CCTTATATGCCAAATGGGAATGG + Intronic
1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG + Intronic
1126695845 15:51324609-51324631 AATTATTAGCCAAAAATAAAAGG + Intronic
1126872934 15:53009125-53009147 TATTATATGGCAAAGGTGAATGG + Intergenic
1127020568 15:54743032-54743054 CACTATATGCCAAAACTTATGGG + Intergenic
1129010254 15:72409657-72409679 CATTATATGACTAAATTGACAGG + Intergenic
1130046457 15:80449334-80449356 CATTATGTCCCCAAACTGAAGGG - Intronic
1134173170 16:11985099-11985121 AATTATAGGCCAAAAAAAAAAGG - Intronic
1137413953 16:48254987-48255009 CATTACCTGCCTAGAATGAAGGG - Intronic
1137473821 16:48789357-48789379 CATTAAATGCCAGAGATGGATGG + Intergenic
1137496565 16:48973748-48973770 CATTATATACCAAAGATCCAGGG + Intergenic
1138950144 16:61902860-61902882 CATTTTATACAATAAATGAAAGG - Intronic
1139127244 16:64093380-64093402 TAGTATATGGAAAAAATGAACGG + Intergenic
1139818397 16:69697067-69697089 AATTATCTGTAAAAAATGAAGGG + Exonic
1140026379 16:71293887-71293909 CCTTATCTTCCAAAAAAGAACGG - Intergenic
1140705877 16:77628725-77628747 TATAATTTGCCAAAATTGAATGG - Intergenic
1141655292 16:85412826-85412848 CTTTATATGGCAAAAAGGTAAGG - Intergenic
1146099259 17:29963321-29963343 CATTACATTCATAAAATGAAGGG - Intronic
1146422450 17:32700594-32700616 CTTTATATTCCAAAAAGGAGAGG + Intronic
1147872185 17:43595329-43595351 TATTATATGCTAAAAAGGGATGG + Intergenic
1150030978 17:61735284-61735306 TATTATATAGCAAAAATGATGGG + Intronic
1150257658 17:63761122-63761144 CATTTTAAGTCAAACATGAAGGG + Intronic
1150587718 17:66533606-66533628 CCTTAGATGGGAAAAATGAATGG - Intronic
1152978402 18:247610-247632 CATTATATTCAAAAAAAGCAAGG + Intronic
1153003798 18:479963-479985 CATTAGAAGCTAAAAATGCAAGG - Intronic
1153110629 18:1582094-1582116 CATTATATGGCAAAAGTGAAAGG - Intergenic
1153503251 18:5769903-5769925 CTTTCTATGGCAACAATGAATGG - Intergenic
1155612758 18:27685353-27685375 CGTTATTTTCCTAAAATGAATGG + Intergenic
1155628856 18:27867820-27867842 CATTTTCTACCAAAATTGAATGG - Intergenic
1155760849 18:29564476-29564498 CATAACATGCCAAAAATCAACGG + Intergenic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1156245586 18:35294711-35294733 CAATATATGCCTTAAATCAAAGG - Intergenic
1156759727 18:40573854-40573876 AATTATATGCCAAATAGGAGTGG - Intergenic
1157047360 18:44118471-44118493 CATTATGTTCTCAAAATGAAGGG - Intergenic
1157414565 18:47491036-47491058 AATGACAAGCCAAAAATGAAAGG - Intergenic
1158467102 18:57700337-57700359 CATTTTTGGCCATAAATGAATGG + Intronic
1158543349 18:58375958-58375980 CTTCATATGTTAAAAATGAAAGG - Intronic
1158790232 18:60771164-60771186 TCTTATATGCCCACAATGAAAGG - Intergenic
1159219891 18:65447044-65447066 CAGAATATGGCAAAAATGATGGG + Intergenic
1159704616 18:71672084-71672106 AATTATATGATAAAAATTAAAGG - Intergenic
1160116918 18:76087340-76087362 CATTATATGTGCAAAATGAAAGG + Intergenic
1164018841 19:21278531-21278553 CATTTTATACCAGAAATGAAGGG - Intronic
1164948808 19:32318809-32318831 CTTTAGGTGACAAAAATGAACGG + Intergenic
1165848422 19:38834365-38834387 CATTAAATGTTAAAAATGTAAGG + Intronic
1166189866 19:41169348-41169370 AGCTATATGCCAAAAATCAATGG - Intergenic
1166847529 19:45738321-45738343 TATTGTATGTCAAAAATGCATGG + Intronic
1167405767 19:49307392-49307414 CAATATATGATAAAATTGAAGGG + Intronic
924983138 2:241792-241814 AAGTATATTTCAAAAATGAAGGG + Intronic
926499143 2:13631361-13631383 CACTATATGCCAGAGAGGAATGG - Intergenic
926722616 2:15972425-15972447 CATTATATGGAACAAATGATAGG + Intergenic
926980697 2:18564051-18564073 AGTTCTATGCCAAAAATGAACGG - Exonic
926992189 2:18692023-18692045 GATTATATGCCCCAAATTAATGG + Intergenic
928413583 2:31072875-31072897 CATTATGTGTAAAAAATGCAGGG - Intronic
928600007 2:32895191-32895213 CATTATATGGCAAAAGTGGAGGG + Intergenic
929747572 2:44674846-44674868 CATTACATGCCAAGAATGTGAGG - Intronic
930220077 2:48737240-48737262 CATTATCTGTGGAAAATGAATGG - Intronic
930454679 2:51591795-51591817 CATTATATGCCAGAACTTTAAGG - Intergenic
930561381 2:52963568-52963590 CATTATATGGCAAAAGTGGCAGG - Intergenic
930845739 2:55901770-55901792 CAGTATATGGCAAAATTGATGGG + Intronic
931785320 2:65612843-65612865 CAAATTATGCCAAAAATAAATGG - Intergenic
931817229 2:65916587-65916609 CTTTTTTTGCCAATAATGAATGG + Intergenic
931909119 2:66875731-66875753 CATTATGTGGCACAAATGAGAGG - Intergenic
933042427 2:77486614-77486636 CATTATATGCTAAATATAACTGG - Intronic
933106432 2:78332757-78332779 CAATAGATGCCAAAAGTGAATGG + Intergenic
934053306 2:88228416-88228438 TATGAGATGACAAAAATGAAGGG + Intergenic
935194579 2:100804887-100804909 CATTTTATGAAAAAAATAAAAGG + Intergenic
936636955 2:114269928-114269950 TATTGAATCCCAAAAATGAACGG - Intergenic
936665155 2:114586334-114586356 TATTATATGGCAAATATCAAGGG - Intronic
937481340 2:122262972-122262994 TATTATATGTCAATGATGAAAGG + Intergenic
937523496 2:122739275-122739297 CATCAGATGCCACAAATTAAAGG - Intergenic
938021684 2:127911008-127911030 CATTAGAGACCAAGAATGAACGG + Intergenic
939356018 2:141103140-141103162 CATTTGATGCCAAAAAAAAAAGG + Intronic
939382998 2:141460325-141460347 CAGTTCATGCCAAAAATGTAAGG + Intronic
939383253 2:141463962-141463984 CAATATCTGCCAAACTTGAATGG - Intronic
939879835 2:147618043-147618065 CATTATCTTCGAAAAAAGAAAGG + Intergenic
940333205 2:152498088-152498110 CATTATATGGCAAAGGTGAAAGG - Intronic
940970896 2:159895491-159895513 CTTTGTATTCCAAAAATCAAAGG - Intronic
941105566 2:161348348-161348370 CCATATATTACAAAAATGAATGG + Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
942741601 2:179186936-179186958 CATTATAAGCCAAAAGAGACTGG + Intronic
943969267 2:194382393-194382415 CAATATATTCCAAAATTGTATGG - Intergenic
944231346 2:197396361-197396383 CATTATAAGTCAAAAATTTATGG + Intronic
945307900 2:208276607-208276629 AATTATATGCCAACAATAAGAGG + Intronic
945629561 2:212256180-212256202 AAATATATGGCAAAAATCAATGG - Intronic
945637119 2:212369147-212369169 AATTATTTGCCAAAATTAAAAGG + Intronic
945709854 2:213282408-213282430 CTGGATATGCCAAAAATGTAAGG + Intergenic
946894273 2:224307124-224307146 TATTATTTGCCAAGCATGAAAGG - Intergenic
948569018 2:238905590-238905612 CATGAAAAGCCAAAAATGACAGG - Intronic
1168902382 20:1376026-1376048 CATTATATGTGAAAGATGATGGG - Intronic
1169148089 20:3267331-3267353 CATTTTATGCCAATAAAGCAAGG - Intronic
1169398742 20:5260834-5260856 CCTTCTATGGCAAAAATGAGTGG + Intergenic
1169813400 20:9631353-9631375 CATTATATGGCAACACTGATGGG + Intronic
1170013302 20:11751633-11751655 CAGTAGATGTTAAAAATGAATGG - Intergenic
1170207161 20:13810903-13810925 TAATATATGCTAAGAATGAAAGG + Intronic
1170263094 20:14434471-14434493 CATCAGGTGCCAAAAAGGAAAGG - Intronic
1170263924 20:14443607-14443629 TATTATATGCCAAAATGGAAAGG + Intronic
1170473757 20:16693983-16694005 AATTTTATGACAAAAATGAAGGG + Intergenic
1172615147 20:36278445-36278467 CAATAAATGCCTTAAATGAATGG - Intergenic
1173213387 20:41055907-41055929 CATAATAACACAAAAATGAAGGG + Intronic
1174907575 20:54567978-54568000 TATCATAGGCCAAAAATGACTGG - Intronic
1174990646 20:55505595-55505617 CATTATATGGCAAAGGTGATGGG - Intergenic
1177760565 21:25398481-25398503 CACTGTATTCTAAAAATGAATGG + Intergenic
1183885943 22:40882156-40882178 CATCTTCTACCAAAAATGAAAGG + Exonic
950012891 3:9735696-9735718 AATTAAATGACAAAAATAAAAGG - Intronic
950888278 3:16379930-16379952 CAACATATGCCAAAAGAGAAAGG + Intronic
951023828 3:17809630-17809652 CACTATATGGCAAAAGTGATAGG + Intronic
951697078 3:25456269-25456291 CCTTAAATACCAAAAATGACTGG + Intronic
951928394 3:27935954-27935976 TATAATATGTCAAAAATGATGGG + Intergenic
952115111 3:30169437-30169459 GATAATATGGCAAAAGTGAAGGG - Intergenic
953109797 3:39922854-39922876 CAATATATGCCAAGACTGAGAGG + Intronic
953126793 3:40098253-40098275 CATTTTCTGGCAAAAATCAATGG - Intronic
953176276 3:40555762-40555784 AATTATAGGACAAAACTGAAAGG - Intronic
953598579 3:44340546-44340568 CAATTTATGCTAAAAATCAAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956455677 3:69418479-69418501 CATTATATGCCCAAGGTGATGGG + Intronic
957178910 3:76850803-76850825 CATAATATCCTAAAATTGAATGG - Intronic
957627196 3:82668452-82668474 GCTTATATGCCATAAATAAAGGG - Intergenic
959248936 3:103914678-103914700 CATTGAATGGCAAAAATGAAAGG + Intergenic
959316827 3:104820187-104820209 CATTATATGAGAGAAATAAAAGG + Intergenic
959429065 3:106229614-106229636 CATTATATGGCAAAAGTGAGGGG + Intergenic
959885474 3:111494289-111494311 CCTTACAAGCTAAAAATGAATGG - Intronic
960082181 3:113553340-113553362 AATTATATCACAAAAATAAAAGG + Intronic
960593544 3:119388197-119388219 CAGTATAAGACAAAAATAAATGG - Intronic
962456373 3:135568866-135568888 CATAATATCTCAAAAATGAATGG - Intergenic
962513404 3:136125801-136125823 CAGTTTATTCCAGAAATGAAAGG + Intronic
963776045 3:149441870-149441892 CATGAAATGCCAAGAATGATGGG - Intergenic
963828399 3:149981321-149981343 CACTCTCTGCAAAAAATGAAAGG + Intronic
963953470 3:151227760-151227782 CATTATAGGCAAAAAATTACAGG - Intronic
964418611 3:156477005-156477027 CAATATATTCCTAAAATTAAAGG - Intronic
966096377 3:176208732-176208754 AATTATATTACAAAAATAAATGG + Intergenic
970125300 4:12803086-12803108 AAGTATGTGCAAAAAATGAAAGG + Intergenic
974855986 4:67461138-67461160 CAATATCTTTCAAAAATGAAGGG + Intergenic
974875250 4:67696229-67696251 TATTATTGTCCAAAAATGAAAGG + Intronic
975956957 4:79852567-79852589 CCTCATATGCCATAAATGACAGG - Intergenic
976120142 4:81771242-81771264 CATTCTTTACCAAAAATAAATGG + Intronic
978013458 4:103715786-103715808 TACTATATGCCGTAAATGAATGG + Intronic
978194341 4:105953444-105953466 CATTATAAGCCAAAAGAAAAGGG - Intronic
978265690 4:106821877-106821899 CATTAAATGATTAAAATGAAGGG - Intergenic
978937738 4:114398919-114398941 CATTAAATGGCATAAATAAAAGG - Intergenic
979375117 4:119937478-119937500 CATTTTATGCCAAATTTCAAGGG - Intergenic
979394289 4:120167529-120167551 CACAATATGCAATAAATGAAAGG + Intergenic
979723437 4:123931474-123931496 CACCAGGTGCCAAAAATGAAGGG - Intergenic
980028038 4:127789668-127789690 CATTTTATGGCTAAAATAAAGGG - Intronic
980711599 4:136575989-136576011 CATGACATGCCAAAACTGGATGG - Intergenic
981191259 4:141866802-141866824 CATTATATGCCAGAAGAGACCGG - Intergenic
981233763 4:142390668-142390690 CAATATCTTCCAAAATTGAATGG + Intronic
981840403 4:149105039-149105061 CATAATATTCCAAAAATAATGGG - Intergenic
982976652 4:162070716-162070738 CCTTACAGGCCAAAAAAGAACGG + Intronic
982982322 4:162155157-162155179 CATTATATGGCAAAAAGGAAGGG + Intronic
984355246 4:178650843-178650865 CCTTATAGGCCAGAAGTGAACGG - Intergenic
984417148 4:179476716-179476738 CATGAAATGCATAAAATGAAAGG - Intergenic
984447570 4:179856288-179856310 CATTATAAGCCAGAATTTAACGG + Intergenic
985178045 4:187224266-187224288 CACAATAAGCCAGAAATGAAGGG - Intergenic
985288334 4:188360562-188360584 AATTATATGCCAGAAATATATGG + Intergenic
986912824 5:12577653-12577675 CACTATATGCCAAAAATTTAAGG + Intergenic
987625759 5:20398282-20398304 CATTTTAAGAAAAAAATGAAAGG - Intronic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
987658134 5:20835096-20835118 AATTAAATGCCTAAAATGTATGG + Intergenic
987661152 5:20878093-20878115 AATTTTATCCCAGAAATGAAAGG + Intergenic
987759308 5:22139494-22139516 CTTTAAATTCCAAAAATGTATGG + Intronic
988365035 5:30287595-30287617 CCTTATATGCAAGAAAAGAATGG - Intergenic
988762435 5:34327260-34327282 AATTTTATCCCAGAAATGAAAGG - Intergenic
988765549 5:34370840-34370862 AATTAAATGCCTAAAATGTATGG - Intergenic
988787527 5:34578586-34578608 CCTTATAGGCCTAAAATCAAGGG + Intergenic
989388198 5:40873860-40873882 GGTTATTTGCTAAAAATGAATGG + Intergenic
990040220 5:51370466-51370488 CATTATATGGCAAAAGTGAAAGG + Intergenic
990277103 5:54209069-54209091 CATAATATGACAGCAATGAATGG + Intronic
991098468 5:62764872-62764894 CATTATATGTCAGAAAAGCATGG - Intergenic
991894025 5:71372923-71372945 CTTTAAATTCCAAAAATGTATGG + Intergenic
992499635 5:77329307-77329329 CATTATATGCCAAAAATGAATGG + Intronic
992938201 5:81733961-81733983 AATTATATGAAAAAAATCAAAGG + Intronic
993650055 5:90509158-90509180 CATTATGTAACAAAAATTAAGGG - Intronic
993726636 5:91375527-91375549 CCTTAAGTGCCAAAATTGAAAGG - Exonic
994301544 5:98154021-98154043 AATTATATGCCAAAAAAAATTGG + Intergenic
994428100 5:99621054-99621076 TATAATATCCCAAAGATGAAAGG - Intergenic
994621575 5:102169880-102169902 ACTTATATGCAAAAAATAAAAGG + Intergenic
994898517 5:105738839-105738861 AATTATGTGGCAAAAATGAATGG - Intergenic
996304649 5:122033320-122033342 GATTATATGGCAGAAATAAATGG - Intronic
996378129 5:122836916-122836938 GATTAGATACCAAAAAAGAATGG + Intergenic
996642875 5:125778253-125778275 CATTATATTACAATAAAGAATGG - Intergenic
998365335 5:141627024-141627046 AATTATATTCCAAAGATGATGGG - Intronic
998936652 5:147236182-147236204 AATTACAGGCCAAAGATGAAAGG + Intronic
999841942 5:155437617-155437639 CATTACATGCCCAAAGTGCAAGG + Intergenic
999885038 5:155912905-155912927 ACTTAAATGCCAAGAATGAAAGG - Intronic
1001220881 5:169899728-169899750 CTTTGTATGCCAACAAGGAATGG - Intronic
1004544944 6:16588702-16588724 CATTGAATCCCAAAGATGAAAGG - Intronic
1007544172 6:42679406-42679428 CATTAAATGATAAAAATGTATGG - Intronic
1008134621 6:47759651-47759673 CATTAGATGTGAAAAATGGAAGG - Intergenic
1008269204 6:49469696-49469718 CAATTTTTGCCAAAAATGGAAGG - Intronic
1008355556 6:50548330-50548352 CATTATAGGCCTTAACTGAAAGG - Intergenic
1008457734 6:51730866-51730888 TATTTTATGCCTAAGATGAATGG - Intronic
1008823817 6:55666808-55666830 CATCATCTGCCAAAACTGCATGG + Intergenic
1008970366 6:57360347-57360369 CATTAAATGCTGAAAATAAAAGG - Intronic
1009159335 6:60262167-60262189 CATTAAATGCTGAAAATAAAAGG - Intergenic
1009386649 6:63092193-63092215 AATTATATGTCAGAAATGATAGG + Intergenic
1009778617 6:68239032-68239054 AATTATATTCCAAAAAATAAAGG + Intergenic
1011985666 6:93441473-93441495 CAATATATGCCAAAGAGAAATGG - Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012683892 6:102218619-102218641 CATTGTTTGCAATAAATGAATGG + Intergenic
1013240679 6:108242680-108242702 CATTACATGGCAAAGGTGAAGGG + Intronic
1013721339 6:113032312-113032334 TATTAGATGCAAAAAATGAGAGG + Intergenic
1014363017 6:120504139-120504161 CAAAATAGGTCAAAAATGAAAGG - Intergenic
1014527643 6:122520005-122520027 GATTATTTGGCAATAATGAATGG - Intronic
1014545076 6:122725090-122725112 CAATATATTCCACATATGAATGG + Intronic
1015478711 6:133682747-133682769 GATCCTATGCCAAAAATGGATGG + Intergenic
1015687112 6:135876901-135876923 AAATATATGGCAAATATGAAAGG - Intronic
1016850858 6:148617531-148617553 CCTTATCTGCCAAAAAAAAAAGG + Intergenic
1016964960 6:149710257-149710279 TATTCTAAGCCAAATATGAATGG - Intronic
1018441362 6:163816459-163816481 AATTATATGACAAACATCAAGGG + Intergenic
1020506398 7:8994263-8994285 CATTATATGCAAAAAGTATAGGG - Intergenic
1020984463 7:15115171-15115193 CATTTTATCCCAAGAATGCAAGG + Intergenic
1021141760 7:17034163-17034185 CATTATGTGTTAAAATTGAAAGG - Intergenic
1021208756 7:17817574-17817596 CATTATATGTTACACATGAAAGG + Intronic
1022819806 7:33948462-33948484 CATTATATGCCAAGCAAGAATGG - Intronic
1022883432 7:34615898-34615920 CATAACATGCCAAAAATGCATGG + Intergenic
1024614300 7:51096334-51096356 CATAATATGCCAAAACTCATGGG + Intronic
1024728035 7:52221791-52221813 CCTTATATTCAAAAAAGGAAAGG + Intergenic
1024794607 7:53006377-53006399 TATGAAATGCCACAAATGAAAGG + Intergenic
1026118116 7:67513437-67513459 CAGAATATGGCAAAAATGATGGG + Intergenic
1027748675 7:82112330-82112352 CATTATACACCAGAACTGAATGG + Intronic
1029415208 7:100438171-100438193 CATTCTACACAAAAAATGAAAGG - Intergenic
1029885044 7:103860103-103860125 CATTATATCACAAATATCAATGG + Intronic
1030432207 7:109464495-109464517 CTTAATATGCTAAAAATTAAAGG - Intergenic
1030645106 7:112052462-112052484 CATTATATGCCCGAAGTGAGGGG - Intronic
1030984438 7:116224493-116224515 AATTATATTTCAAAATTGAAAGG - Intronic
1031673276 7:124578400-124578422 CATTATATGACAAAAGTAAAGGG + Intergenic
1032599448 7:133277868-133277890 AATTAAAAGCCAAAAATGACAGG - Intronic
1032618652 7:133503306-133503328 CAGAATACACCAAAAATGAATGG + Intronic
1033149892 7:138904890-138904912 CATTCTTTGCCAAGAATGTAAGG + Intronic
1034565794 7:151914609-151914631 CATTATATGGCAAAAATGAGGGG + Intergenic
1038062158 8:23925555-23925577 CCTTATTTGAAAAAAATGAAAGG - Intergenic
1039811763 8:41055238-41055260 CTATATTTGCAAAAAATGAAAGG - Intergenic
1040764818 8:50894882-50894904 CAGTATATGCCGATGATGAATGG - Intergenic
1040985400 8:53288593-53288615 TATTAAATGCCAAAAATAAATGG - Intergenic
1041997290 8:64078467-64078489 AATTATATTACAAAAATGTAAGG - Intergenic
1042760494 8:72267084-72267106 ACCTATATGCCAAAGATGAAGGG - Intergenic
1044289822 8:90454585-90454607 TTTTATTTGCCTAAAATGAAAGG - Intergenic
1045241702 8:100408326-100408348 TAAAATATGCCAAGAATGAAAGG + Intronic
1045303998 8:100940985-100941007 CATTAGATGGCAACAATCAAAGG + Intronic
1046290138 8:112148455-112148477 CTTTATTTTACAAAAATGAAGGG - Intergenic
1046761519 8:118026293-118026315 CATTAGATTCCCAAGATGAAAGG + Intronic
1047373112 8:124272567-124272589 CATTAAGTGGAAAAAATGAAAGG - Intergenic
1047698851 8:127430359-127430381 CAAAATATGCCAAAAAGAAAAGG - Intergenic
1048375143 8:133816702-133816724 CATTAGATGTACAAAATGAAAGG - Intergenic
1050719259 9:8566694-8566716 GATTATTTGCCAAATAAGAATGG + Intronic
1051122763 9:13769870-13769892 TATTAGATGCCACAAATAAAGGG + Intergenic
1051223691 9:14876874-14876896 CGTTAGATGCCAAATGTGAATGG - Intronic
1052566420 9:30159286-30159308 GATTATACGGTAAAAATGAAGGG - Intergenic
1052570011 9:30208709-30208731 CATAATATGATAGAAATGAAAGG + Intergenic
1052577297 9:30306520-30306542 CATTATATACCAAAATTTATAGG + Intergenic
1054975915 9:71144868-71144890 TATTATATCCTAAAAATAAATGG + Intronic
1055715188 9:79109776-79109798 CAGTATATGCATATAATGAAAGG + Intergenic
1057288505 9:93781557-93781579 CAATATATGCTAAAGATGGATGG - Intergenic
1059140649 9:111849780-111849802 TATTAAATGCAAATAATGAAAGG - Intergenic
1059733750 9:117081556-117081578 CATTATATGACAAGGGTGAAAGG + Intronic
1186607262 X:11105299-11105321 CATGATGTGCCAAAAAAGATGGG - Intergenic
1188218229 X:27505676-27505698 CAGAATATGACAAAAGTGAAGGG + Intergenic
1188226147 X:27600613-27600635 AAGTATAAGACAAAAATGAATGG + Intronic
1188340362 X:28993217-28993239 AATTATACAGCAAAAATGAAAGG + Intronic
1188388832 X:29594597-29594619 AAATATTTGGCAAAAATGAATGG + Intronic
1188706045 X:33331860-33331882 AATTATATGCCTAACATGACTGG - Intronic
1188707666 X:33355983-33356005 CTTTAGATGCCAGAAATTAAGGG - Intergenic
1191770655 X:64754622-64754644 CCTTATAGGCCAAGAAAGAATGG - Intergenic
1192693457 X:73390073-73390095 CATAATATGCCAAAACTTATGGG + Intergenic
1193263884 X:79444428-79444450 CATTATATCAACAAAATGAAGGG - Intergenic
1193568646 X:83113153-83113175 AATTATATTCCAAAAAGTAATGG - Intergenic
1195244420 X:102982726-102982748 CATCATATGACAAAAAGGAAAGG + Intergenic
1195467168 X:105192159-105192181 CAGTATTTGCCAAATATGTATGG + Intronic
1195554465 X:106206020-106206042 CATTATCTTCCGAAAGTGAAGGG - Exonic
1195698871 X:107686912-107686934 TATTAAATGCCTAAATTGAAGGG + Intergenic
1195783957 X:108496235-108496257 CATAACATGTCAAAAATGAGTGG - Intronic
1195991360 X:110685664-110685686 CATTATAGACCAAGATTGAATGG - Intronic
1196276810 X:113775813-113775835 CAGTAAATGCCAAAATTGAGGGG + Intergenic
1196581728 X:117387552-117387574 CATTCTATGTCATAAATGATAGG + Intergenic
1197944028 X:131818974-131818996 TATTATATGGCAAAAATGATAGG - Intergenic
1198006261 X:132497630-132497652 CATTCTATCCCAAAAAAGGAAGG - Intergenic
1199053830 X:143269172-143269194 TATTATATGCTAAAACTAAAAGG - Intergenic
1199194028 X:145005887-145005909 CAGAATATTCCAAAAATAAAAGG - Intergenic
1199231179 X:145437584-145437606 CAATATATGATAAAATTGAAGGG + Intergenic
1199545841 X:149006731-149006753 CATTATACGGCAAAGGTGAAGGG - Intergenic
1199748700 X:150794002-150794024 GATTACATGCCAAAGGTGAAGGG + Intronic
1199813646 X:151376523-151376545 CATTAAATCACAAAAGTGAAAGG + Intergenic
1201668790 Y:16491526-16491548 GATTATATGCTAAAAAGAAAAGG + Intergenic