ID: 992503894

View in Genome Browser
Species Human (GRCh38)
Location 5:77366885-77366907
Sequence CTGGACCAAAGCGCCCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992503894_992503904 29 Left 992503894 5:77366885-77366907 CCATCAAGGGCGCTTTGGTCCAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 992503904 5:77366937-77366959 GTGCAAGGTCAGGCCCAAGTAGG 0: 1
1: 0
2: 0
3: 13
4: 117
992503894_992503902 14 Left 992503894 5:77366885-77366907 CCATCAAGGGCGCTTTGGTCCAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 992503902 5:77366922-77366944 ATCTGTGCAGAGAATGTGCAAGG 0: 1
1: 0
2: 3
3: 25
4: 224
992503894_992503903 19 Left 992503894 5:77366885-77366907 CCATCAAGGGCGCTTTGGTCCAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 992503903 5:77366927-77366949 TGCAGAGAATGTGCAAGGTCAGG 0: 1
1: 0
2: 1
3: 18
4: 226
992503894_992503897 -10 Left 992503894 5:77366885-77366907 CCATCAAGGGCGCTTTGGTCCAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 992503897 5:77366898-77366920 TTTGGTCCAGATGTCCCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992503894 Original CRISPR CTGGACCAAAGCGCCCTTGA TGG (reversed) Intronic
900590202 1:3456066-3456088 CTGGACCAAAGTCACCTGGAGGG + Intronic
904884553 1:33726399-33726421 CTGGACCAAATTGCCCTGGGTGG - Intronic
1064392019 10:14950584-14950606 CTGGACCAGATATCCCTTGAGGG - Intronic
1065199998 10:23303816-23303838 GTGGACAAAAGTTCCCTTGAGGG + Intronic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1081541356 11:44036862-44036884 CTGGACCACAGTTTCCTTGATGG + Intergenic
1089762630 11:120739449-120739471 ATGGACCAGAGCTCCCTTGGAGG + Intronic
1092064104 12:5575248-5575270 CCAGACCATAGCCCCCTTGATGG + Intronic
1095864280 12:46954576-46954598 CTGGACCACTGGGCCCTTGTGGG + Intergenic
1095876167 12:47080970-47080992 CTGAACCAAAGCGCGCTGGTCGG - Intronic
1106098149 13:26668560-26668582 ATGGGCCAAAGGGCCCCTGAGGG - Intronic
1114640559 14:24216947-24216969 CTGGCCCAGAGGGCCCTTGCTGG - Exonic
1117324796 14:54659012-54659034 CTGGCTCACAGGGCCCTTGAGGG + Intronic
1118694018 14:68366536-68366558 CTGGACTAAAGCAGCCTTGAAGG + Intronic
1127277911 15:57463576-57463598 CTGGAACAAACAGCCCTTGCTGG - Intronic
1128338379 15:66803021-66803043 CTGGACCAAAGCACCATGGTGGG + Intergenic
1134640517 16:15826252-15826274 CTTGACTAAAAGGCCCTTGAGGG - Intronic
1138347751 16:56330365-56330387 CTGGCCCTAAAGGCCCTTGAGGG - Intronic
1140188332 16:72794038-72794060 GTTGACCAAAGCGGCCATGATGG - Exonic
1141136699 16:81470301-81470323 CTGGACCCAAGCTGCCTGGACGG - Intronic
1143644532 17:8221764-8221786 CTGGACCACCGCGCTCCTGACGG + Intergenic
1143914043 17:10275798-10275820 CTGGACCACAGCTGCCCTGATGG + Intergenic
1144675885 17:17161321-17161343 CGGGAGCAGAGCGCCCGTGAGGG + Exonic
1151987990 17:77556338-77556360 CTGGACCAAAGCCCCCTCCGAGG - Intergenic
1152386685 17:79979085-79979107 CTAAACCAAAGCGCCCTCGTGGG + Intronic
1152667539 17:81580039-81580061 CAGGAGCATAGCGCCCTGGAAGG - Intronic
1152895556 17:82909075-82909097 CAGGCCCAGAGCTCCCTTGAAGG - Intronic
1153919011 18:9772082-9772104 CAGCCCCAAAACGCCCTTGAAGG - Intronic
1159891972 18:73961477-73961499 CTGGAATGAAGAGCCCTTGAAGG + Intergenic
1162418681 19:10553356-10553378 CTGTCCCAAAGCCCCCTTGGGGG + Exonic
926914116 2:17877363-17877385 CTGGACCAAAACTCCCTTTAAGG + Intergenic
930994689 2:57702221-57702243 CTGGAGGAAAGCACGCTTGAGGG + Intergenic
937640734 2:124208198-124208220 CTGGACCACAGAGCAATTGAAGG + Intronic
939992479 2:148888393-148888415 CAGGACAAAAGCGCCCATTAGGG + Intronic
949071872 2:242030230-242030252 CTGGCCCACACCCCCCTTGAAGG - Intergenic
1170998419 20:21389117-21389139 CTGGATCAAAGCACCTTTTATGG + Intronic
1184340359 22:43882417-43882439 CTGCACCACAGCACCCTTGGAGG + Intronic
1185065484 22:48629823-48629845 CTGGATCACAGCCCCCTGGATGG + Intronic
953626822 3:44578885-44578907 CGGGAGCAGAGCGCCCGTGAGGG - Intronic
958061668 3:88491274-88491296 TTGGACCAAAGGTACCTTGAGGG - Intergenic
968401874 4:305125-305147 CTGGGCCAAAGCCGCCTTGCGGG + Intronic
980009465 4:127579759-127579781 CTGGAGCAAAGCACCCATGCTGG - Intergenic
984473866 4:180213079-180213101 CTGAATCAAAGAGCCCTTGAAGG + Intergenic
986172234 5:5324419-5324441 CTGGAACAAAAAGCCCTTGAAGG - Intergenic
992414188 5:76537045-76537067 CTGTACCAAAGCTATCTTGAGGG + Intronic
992503894 5:77366885-77366907 CTGGACCAAAGCGCCCTTGATGG - Intronic
996038542 5:118785498-118785520 CTGGACCAGAAACCCCTTGAAGG - Intergenic
998050151 5:139025658-139025680 CTGGAGCACAGCGGCCTGGAGGG - Intronic
1000159956 5:158587467-158587489 CTGGTTCAAAGCTCCCTTCATGG + Intergenic
1000334035 5:160228766-160228788 CTGGAGCAAAGCAAACTTGAAGG - Intronic
1002852402 6:1008103-1008125 CTAGACCAAAGCGCTCTTTGTGG + Intergenic
1004449978 6:15736374-15736396 ATTGACCAGAGTGCCCTTGAAGG - Intergenic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1011181421 6:84625905-84625927 CTGGACCAAAAGGCCTTTGGAGG - Intergenic
1016044845 6:139470537-139470559 CTGGAGGAAAGAGCCCATGAAGG - Intergenic
1017754718 6:157519667-157519689 CTGGACCACACAGCTCTTGAGGG - Intronic
1019026617 6:168970894-168970916 CTGGAGCCAAGCCCCCATGATGG - Intergenic
1019423686 7:963332-963354 CAGCACCACAGCACCCTTGAGGG - Intronic
1019639503 7:2095911-2095933 CAGAAGCAAAGCTCCCTTGAGGG - Intronic
1021115342 7:16740586-16740608 CTGGATCAAAGAGTGCTTGAAGG + Intergenic
1022505121 7:30904935-30904957 CTGGAGGAAAGGGCCCATGAAGG - Intergenic
1023752926 7:43388990-43389012 CTGGACCAAGGTGCCAGTGATGG + Intronic
1025035039 7:55588645-55588667 CTGGATCACAGCAACCTTGAAGG + Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1039247038 8:35620414-35620436 CAGGACCAAAGAACCTTTGATGG - Intronic
1041184215 8:55282075-55282097 CTGGTCCAAAACTCACTTGAGGG + Intronic
1056591631 9:87969681-87969703 CTGGCCCCAACCCCCCTTGATGG - Intronic
1057199417 9:93132403-93132425 CTGGACCACAGAGCACATGAGGG - Intronic
1058090013 9:100795131-100795153 CTGGGCCAAAGTGCCTTTCAAGG - Intergenic
1058925199 9:109656311-109656333 CTGGACCTAAGTGGCCTAGAAGG - Intronic
1059325506 9:113501787-113501809 CTGGACCCAAGGCCCCTTTAGGG + Intronic
1059517220 9:114907257-114907279 CTGGTCCAAAGCTCTCTTGGTGG + Intronic
1059654258 9:116343012-116343034 CTGGACTAGAACGTCCTTGAGGG - Intronic
1061719622 9:132543555-132543577 CTGGACCAAACCTCCCTCCAGGG + Intronic
1195934235 X:110109749-110109771 CTGGACCAAACAGCCCCTCATGG + Intronic
1200019553 X:153190418-153190440 CTGGAGCAAAGTCCTCTTGAAGG + Intergenic