ID: 992507742

View in Genome Browser
Species Human (GRCh38)
Location 5:77404923-77404945
Sequence AATAAGCTCAAAGGTTTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992507738_992507742 -9 Left 992507738 5:77404909-77404931 CCGACTTATTTTTCAATAAGCTC 0: 1
1: 0
2: 3
3: 23
4: 309
Right 992507742 5:77404923-77404945 AATAAGCTCAAAGGTTTTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 189
992507737_992507742 15 Left 992507737 5:77404885-77404907 CCAAAGAGTAAGAGTTCAACAAC 0: 1
1: 0
2: 0
3: 13
4: 159
Right 992507742 5:77404923-77404945 AATAAGCTCAAAGGTTTTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992507742 Original CRISPR AATAAGCTCAAAGGTTTTAG GGG Intronic