ID: 992509162

View in Genome Browser
Species Human (GRCh38)
Location 5:77416411-77416433
Sequence GACCCAGGACAGCCCCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992509162_992509167 19 Left 992509162 5:77416411-77416433 CCAGGTTGGGGCTGTCCTGGGTC 0: 1
1: 0
2: 4
3: 26
4: 247
Right 992509167 5:77416453-77416475 AACGTGCCTGCAGGTGACCGTGG 0: 1
1: 0
2: 0
3: 7
4: 80
992509162_992509166 10 Left 992509162 5:77416411-77416433 CCAGGTTGGGGCTGTCCTGGGTC 0: 1
1: 0
2: 4
3: 26
4: 247
Right 992509166 5:77416444-77416466 AGATCGCTGAACGTGCCTGCAGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992509162 Original CRISPR GACCCAGGACAGCCCCAACC TGG (reversed) Intronic
900144426 1:1151679-1151701 AACCCAGAACGGCCCCACCCAGG + Intergenic
900652856 1:3739104-3739126 GACCCAGGCTAGCCGCTACCAGG - Intergenic
900746007 1:4361243-4361265 GACCCAGATCAGCCCCCACAGGG - Intergenic
901055603 1:6447516-6447538 GGCAGAGGACAGCCCCCACCCGG + Intronic
901523957 1:9807703-9807725 GAGGCAGGAGAGCCACAACCGGG - Intronic
902470589 1:16645580-16645602 GACCCACCACAGCCCCATCCGGG - Intergenic
903060334 1:20664509-20664531 CTCCCAGGGCAGCCCCAACCAGG - Exonic
905102973 1:35541716-35541738 GACCAAAGACAGAGCCAACCTGG + Intronic
905256952 1:36690988-36691010 GGCCCAGGACAGCACCATCAGGG - Intergenic
908806784 1:67940031-67940053 GATCCAGGCCGGCCCCATCCAGG + Intergenic
911062032 1:93757082-93757104 GACCCAGAACAGACCCCAACCGG - Intronic
912492529 1:110070164-110070186 GGCCCGGGCCAGCGCCAACCCGG + Intronic
912496284 1:110094137-110094159 GAACCTGGACTGCCCCAAGCAGG - Intergenic
912505926 1:110156086-110156108 GACCATGGACAGCGCCCACCGGG - Intronic
916577400 1:166079893-166079915 AACCCAGGACAGTTCCAACCTGG + Intronic
917932907 1:179836833-179836855 CACCCAGTAGAGCCCCCACCGGG + Intergenic
919092826 1:192994680-192994702 GACCCAGGACACCCAGAAGCCGG - Intergenic
919907079 1:202085554-202085576 GAGGAAGGACAGCCCCACCCCGG + Intergenic
921213818 1:212920963-212920985 GACCCAGGTAAGCCCCATGCTGG + Intergenic
922621037 1:226988358-226988380 AACCCAGGCCAGCCCCAGCCAGG + Intergenic
923542791 1:234900701-234900723 GACACAGGTCAGACCCAATCAGG + Intergenic
1067570615 10:47368573-47368595 GCCCCAGGCAAGCCCCGACCTGG - Exonic
1067695990 10:48536025-48536047 GACCCAGGCCAGCCTCTGCCGGG - Intronic
1069156701 10:65038267-65038289 GACCAGTGACATCCCCAACCAGG - Intergenic
1075972224 10:126664531-126664553 GAGCCCAGACAGCCTCAACCCGG + Intronic
1076855809 10:133115190-133115212 GACTCGGGACAGCCCCACTCAGG - Intronic
1077012238 11:384523-384545 GGCCCAGGAAGGCCCCCACCCGG + Intergenic
1077048923 11:558092-558114 CCCCCAGGCCAGCCCCAGCCTGG + Intronic
1077216771 11:1398310-1398332 GGCCCAGGCCAGCCCCAACCAGG - Intronic
1077432261 11:2521783-2521805 GTCCCGGCACAGCCCCCACCCGG + Intronic
1077499633 11:2903302-2903324 GACCCAGGAGAGATCCAAGCAGG - Exonic
1079742662 11:24082993-24083015 GAGGCAGGAGAGCCCTAACCTGG + Intergenic
1080596334 11:33777131-33777153 GACCCAGGAGAGCCCTTTCCTGG + Intergenic
1081809340 11:45906396-45906418 GACACAGGCCAGCCCCATCTTGG + Exonic
1083803587 11:65060433-65060455 GACACAGGACAGTCACCACCAGG + Intergenic
1083878252 11:65536015-65536037 AGCCCAGGACACCCGCAACCCGG - Exonic
1083920559 11:65779868-65779890 CCCCCAGGCCAGCCCCAACCCGG + Exonic
1084526376 11:69700914-69700936 GACCCAGGACAGGCGCAGGCGGG + Intronic
1089917112 11:122168478-122168500 GACCAAAGACAGCTCAAACCAGG - Intergenic
1091740681 12:2959032-2959054 CCCCCGGGACAGCCCCACCCCGG + Intergenic
1092171300 12:6375433-6375455 GTCCCAGTCCAGCCGCAACCTGG - Intronic
1095982933 12:47983041-47983063 GACCCAGGGCAGGCCCAAGGAGG + Intronic
1101453204 12:104800881-104800903 AACCCAGGACGGGCCCATCCTGG + Intergenic
1101744921 12:107532223-107532245 GCCCCAGGACAGACCCAACCAGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101875355 12:108593591-108593613 GAACCAGGACTTCCCCACCCTGG - Intronic
1103457827 12:121080094-121080116 GGTCCAGCACAGCCCCATCCTGG + Intergenic
1103847458 12:123911365-123911387 CCCCCAGGACAGACCCACCCAGG - Intronic
1103847842 12:123912201-123912223 CACCCAGGACAGACCCACCCAGG - Intronic
1103847848 12:123912216-123912238 CCCCCAGGACAGACCCACCCAGG - Intronic
1103847893 12:123912322-123912344 CCCCCAGGACAGACCCACCCAGG - Intronic
1104071226 12:125347490-125347512 CACCAAGCACAGCCCCAAACAGG + Intronic
1104456186 12:128914356-128914378 GATCCATGACAGGCCCAAACGGG - Intronic
1104623756 12:130337443-130337465 GGCCCCGGCCAGCCCCACCCAGG - Intergenic
1105265228 13:18809212-18809234 CACCCAGGACAACCCCATCAGGG - Intergenic
1107535211 13:41322632-41322654 GACACAGGACAGACACAGCCAGG - Intronic
1107757559 13:43641279-43641301 GACCCAAGAAAGCCCAAAGCAGG + Intronic
1109442821 13:62397630-62397652 GGCCCAGGCCAGCCACAGCCTGG - Intergenic
1112046374 13:95602109-95602131 GACCCTGGACAGCTGCAGCCTGG + Intronic
1113635601 13:111916983-111917005 GACCCAGGACAGTCTCAAAGTGG - Intergenic
1113904855 13:113814558-113814580 GTCCCAGGGCAGCTCCCACCTGG + Exonic
1114618577 14:24081650-24081672 GCCCCGGGACAGCCCCGCCCCGG + Intronic
1119569840 14:75660833-75660855 CCCCCAGGACAGCTCCAGCCCGG + Exonic
1121404397 14:93710444-93710466 TACCCAGGAGAGCCCAAACATGG + Intergenic
1122115003 14:99523191-99523213 GCCCCAGCCCAGCCCCAGCCTGG - Intronic
1122489196 14:102102153-102102175 GAACTTGGACAGCCCCAAGCAGG + Intronic
1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG + Intergenic
1122627976 14:103093957-103093979 GATCCAGGCCTGTCCCAACCTGG - Intergenic
1122791903 14:104187532-104187554 GACCCTGGACAGCACCCTCCTGG - Intergenic
1122807753 14:104269151-104269173 GACCAAGGTCAGCGCCAACGGGG - Intergenic
1122885560 14:104708890-104708912 GAGCCTGGACAGCCCCTAGCTGG - Intronic
1122967961 14:105140047-105140069 GCCTCAGGACAGCCCCTGCCAGG + Intergenic
1123000177 14:105289479-105289501 GACTCAGGAGAGACCCATCCTGG + Intronic
1123037178 14:105476213-105476235 GACCCTGGAGAGCCCCAGGCTGG - Intronic
1124618021 15:31256559-31256581 CCACCAGCACAGCCCCAACCAGG - Intergenic
1125028774 15:35055841-35055863 GCCACAGGACAGCTCCAAACAGG - Intergenic
1126189787 15:45867395-45867417 GATCCAGGACATCCCAAACTGGG - Intergenic
1126655037 15:50967933-50967955 GTCCCAGCACAGCCACCACCCGG - Intronic
1127178093 15:56382869-56382891 GACCTAGGAAAACACCAACCAGG - Intronic
1128290727 15:66476565-66476587 GAGGCAGGCCAGCCCCAACCAGG + Intronic
1128517409 15:68351311-68351333 GTCCCACGACAGCCCAGACCTGG - Exonic
1129227748 15:74179798-74179820 GAGCCAGGGCAGCCACATCCAGG - Intronic
1129296648 15:74603639-74603661 GAGCTGGGACAGCCCCATCCAGG - Intronic
1129738116 15:77976863-77976885 GACTGGGGACACCCCCAACCGGG - Intergenic
1129853147 15:78806506-78806528 GACCCAGGGCAGGCCCAAGTGGG + Intronic
1130111902 15:80972406-80972428 GACCCAGGTCACCATCAACCAGG - Intronic
1130249820 15:82292581-82292603 GACCCAGGGCAGGCCCAAGTGGG - Intergenic
1131213830 15:90520539-90520561 GCCCCTGGAAAGCCCCTACCTGG - Intergenic
1132674560 16:1116382-1116404 GGCCCAGGACTGCCCCACCATGG + Intergenic
1132744763 16:1432036-1432058 GACCCACAGCAGCCCCAGCCCGG + Intergenic
1132874638 16:2130914-2130936 GACCCAGGTGACCCCCAGCCAGG + Intronic
1132989301 16:2784908-2784930 GACCCAGGACATCCCAACTCAGG - Intronic
1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG + Intronic
1134553580 16:15149747-15149769 GACCCAGGTGACCCCCAGCCAGG + Intergenic
1134648041 16:15886524-15886546 CACACAGGACAGCCTCAAACTGG + Intronic
1135345160 16:21682875-21682897 GTCCCAGGACAGCCACTAGCTGG + Intronic
1135626731 16:24002092-24002114 GACCCAGGACAGAGCCCAGCAGG - Intronic
1135969509 16:27062161-27062183 GACCCAGCAAAGCCCCACCGTGG - Intergenic
1136381522 16:29898245-29898267 GACCCTGGACAGCGCCAGCAAGG + Intronic
1137883072 16:52072844-52072866 TACCCAGGACAACCACTACCAGG - Intronic
1139506423 16:67400241-67400263 GCCCAAGGCCAGCCCCCACCAGG - Intronic
1141795811 16:86273467-86273489 TACCCAGCACAGCCCTAAGCTGG + Intergenic
1142908262 17:3063262-3063284 GACCCTGGACAACCTCATCCTGG - Exonic
1142926304 17:3240999-3241021 GACCCTGGACAACCTCATCCTGG + Intergenic
1142928902 17:3265934-3265956 GGCCCTGGACAACCTCAACCTGG + Intergenic
1142942918 17:3397961-3397983 CACCCAGGACAGCGCCACCAGGG + Exonic
1142946451 17:3433365-3433387 CACCCAGGACAGCGCCACCACGG + Exonic
1143025150 17:3937280-3937302 GACCCTGGAAAGCCCCAGCCAGG + Intronic
1144061154 17:11583925-11583947 GACCCAGCCCAGCCCCATCATGG + Intergenic
1144174632 17:12693261-12693283 GTCCCACGACAGCTCCACCCTGG - Intronic
1144787570 17:17840406-17840428 AACACGGGACAGCCCCACCCGGG + Intergenic
1145346424 17:22044716-22044738 GACCCAGCAGAGCCCGAGCCCGG + Intergenic
1145833353 17:27935491-27935513 GACCCAGAACAGCCCCTCCATGG - Intergenic
1146377277 17:32303180-32303202 GCCCCAGGGCAGCCCCAGGCAGG - Intronic
1146629327 17:34458660-34458682 GAACCTGGACAGCTCCAAGCTGG + Intergenic
1148688296 17:49512898-49512920 CACCCAGGACAGCGCCACACTGG + Exonic
1149470713 17:56913394-56913416 GAGCCAGGCCAGCGCCGACCTGG - Exonic
1150280499 17:63927478-63927500 AACCCAGGGCAGCCTCAAGCAGG + Intergenic
1151926025 17:77197661-77197683 GACCCAAGACTGCACCAGCCTGG - Intronic
1152228169 17:79102215-79102237 GCCCCTGGACAGCCTCACCCAGG - Intronic
1152416727 17:80167480-80167502 GCACCAGGACAGCACCACCCAGG - Intergenic
1152523034 17:80871476-80871498 GACCCAGGCCAGCGCCACCAGGG - Intronic
1152569727 17:81116382-81116404 GGCCCAGGAGAGCCCCACCGAGG - Exonic
1152689708 17:81712404-81712426 GGCCCAGGAGAGCCCAATCCCGG - Exonic
1152701134 17:81820201-81820223 GACCCAGGTGAGCCCAAATCAGG + Intergenic
1153310124 18:3669405-3669427 GGCCCACCACACCCCCAACCTGG + Intronic
1153757375 18:8298042-8298064 TCCCCAGGACAAACCCAACCGGG + Intronic
1154165858 18:12013799-12013821 GCCCAAGGACAGCCCCAGCGAGG - Intronic
1154423166 18:14252332-14252354 CACCCAGGACAACCCCATCAGGG + Intergenic
1156391569 18:36655356-36655378 GGCCCAGGAAAGCCCCAACTAGG - Intronic
1158463540 18:57668646-57668668 GCCCCAGGAGAGCAGCAACCAGG - Intronic
1158706288 18:59795270-59795292 GATGAAGGACAGCCCCACCCAGG - Intergenic
1159786091 18:72716434-72716456 GACCCAGATCAGTGCCAACCTGG + Intergenic
1160316632 18:77854005-77854027 GCCCCAGCATAGCCCCAGCCTGG - Intergenic
1160719921 19:592536-592558 GACCAAGTGCAGCCCCACCCCGG + Intronic
1160809553 19:1007533-1007555 TGCCCAGGACGGCCCCACCCCGG + Intronic
1161310311 19:3590204-3590226 GGCCCAGCACAGCCCCAGCCCGG + Exonic
1161548307 19:4895830-4895852 TGCCCAGGACGGCCCCACCCAGG - Intronic
1161630020 19:5349236-5349258 TACCCAGCACAGACCCCACCTGG - Intergenic
1163323122 19:16586170-16586192 GAGCCTGGGCAGGCCCAACCGGG + Intronic
1163417251 19:17194286-17194308 CACCCACCACAGCCCCAACAAGG + Intronic
1163851873 19:19668939-19668961 GACCCAGGACACCCGGAAGCCGG + Exonic
1165309021 19:35019447-35019469 GACGCAGGGCATCCCCTACCAGG + Exonic
1166073130 19:40398053-40398075 GACCCAGCACATCCCCCGCCTGG - Intronic
1166297316 19:41895458-41895480 GTCCCTGGACAGCCCAGACCGGG + Exonic
1166612124 19:44207767-44207789 GATCCAGGACGCTCCCAACCCGG - Intronic
1167077618 19:47258913-47258935 GACCCAGGCCTGCCCCCTCCAGG + Intronic
1168052799 19:53842183-53842205 GTCCCAGGCCAGCCCTAGCCGGG - Intergenic
925834027 2:7925579-7925601 GACCCAGGATAGCCCTTCCCAGG + Intergenic
926217779 2:10915792-10915814 GACACAGGACAGCCCCTTTCAGG - Intergenic
926504735 2:13699646-13699668 GCCTGAGGACTGCCCCAACCTGG + Intergenic
927207301 2:20618583-20618605 GCCCCAGCACAGACCCAAACTGG - Exonic
927430400 2:23022283-23022305 GACCCATGACAGCCCCACCCAGG + Intergenic
928037734 2:27841077-27841099 GACCCAGGACAGCAGGAAGCGGG - Intronic
928439720 2:31282177-31282199 GACCCAGGAAACCCCCAATATGG - Intergenic
929763820 2:44827802-44827824 GACTCAGGACAGCACCAGACTGG + Intergenic
930841076 2:55845917-55845939 AACCCAGGACAGGCCCATCCTGG - Intergenic
932409387 2:71536248-71536270 TGCCCATGACACCCCCAACCAGG + Intronic
932528161 2:72495934-72495956 GCCCCAGGACAGCAGAAACCTGG - Intronic
933948617 2:87309088-87309110 GTCCCAGGAGAGGCCCACCCAGG - Intergenic
934983761 2:98869418-98869440 GAGCCAGGCCACCCCCATCCCGG - Intronic
935522277 2:104122122-104122144 AACCCAGGACATACCCACCCAGG - Intergenic
936155078 2:110042015-110042037 GCCCCAGGAAAGCCACACCCGGG - Intergenic
936189604 2:110329399-110329421 GCCCCAGGAAAGCCACACCCGGG + Intergenic
936331582 2:111552508-111552530 GTCCCAGGAGAGGCCCACCCAGG + Intergenic
938022545 2:127917899-127917921 CACCCAGGACACCCACAACATGG + Intergenic
938384322 2:130853591-130853613 GACCACGGACAGCCCACACCTGG - Intronic
946230218 2:218286678-218286700 CCCCCAGGAGAGCCCCAGCCGGG - Exonic
946416654 2:219543402-219543424 GGCCCAGGCCCGCCCCAACCTGG - Exonic
948760822 2:240189977-240189999 GGCCCAGGTCAGGCCCAACCAGG - Intergenic
1170267158 20:14479307-14479329 GACACAGGACAGCACCAGCACGG - Intronic
1171521136 20:25774818-25774840 GACCCAGCAGAGCCCGAGCCCGG - Exonic
1171555787 20:26081660-26081682 GACCCAGCAGAGCCCGAGCCCGG + Intergenic
1171886063 20:30653152-30653174 CACCCAGGACAACCCCATCAGGG - Intergenic
1172364025 20:34335051-34335073 GACCCAGGCCAGACCCAGCCAGG - Intergenic
1173360851 20:42343174-42343196 GAGCAAGGACAGCTGCAACCTGG - Intronic
1174208532 20:48858545-48858567 AACACAGGCCAGACCCAACCTGG + Intergenic
1174452022 20:50626283-50626305 GTCCCTGGGCAGCCCCCACCTGG - Intronic
1174983800 20:55426687-55426709 GACCCAGGACTTGCCCAACTTGG + Intergenic
1175171766 20:57085964-57085986 GCCTCAGGGCAGCCCCAAGCTGG + Intergenic
1175215015 20:57387613-57387635 GAAACAGCACAGCCCCATCCAGG - Intergenic
1175418170 20:58815508-58815530 TCCCCAGGACGGCCCCCACCAGG + Intergenic
1176179933 20:63745044-63745066 ACCCCAGGCCAGCCCCACCCCGG - Exonic
1176299229 21:5090766-5090788 GAGCCAGGACACCCCCTCCCGGG - Intergenic
1176516697 21:7789562-7789584 GACCCAGGCCAGCACCCTCCTGG - Intergenic
1176850306 21:13907677-13907699 CACCCAGGACAACCCCATCAGGG - Intergenic
1178650725 21:34419574-34419596 GACCCAGGCCAGCACCCTCCTGG - Exonic
1179545746 21:42111346-42111368 CAGCCAGGAGAGCCCCAGCCAGG + Exonic
1179613837 21:42569216-42569238 GACCCAGGTCAGCCAGAACCTGG + Intronic
1179794704 21:43776203-43776225 GACCCAGCACATCGCCGACCAGG - Exonic
1179857797 21:44171181-44171203 GAGCCAGGACACCCCCTCCCGGG + Intergenic
1180019899 21:45116248-45116270 TACCCAGGCCAGCCCCACCCTGG - Intronic
1180920314 22:19518319-19518341 GGGCCAGGCCAGCCCCATCCTGG + Intronic
1181065073 22:20301777-20301799 GACCCTGCACAGCCCCATGCTGG + Intergenic
1181368493 22:22398362-22398384 GCCACAGAACAGCCCCACCCTGG + Intergenic
1181558886 22:23688315-23688337 GGCCCAGGGCAGGCCCATCCAGG + Intronic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1182537945 22:31019916-31019938 CACCACAGACAGCCCCAACCAGG - Intergenic
1183314385 22:37128955-37128977 GGCCCAGGGCTGCCCCATCCAGG + Intronic
1183489862 22:38110522-38110544 GACCCGGGACAGCCCCTCCATGG - Exonic
1183617895 22:38956199-38956221 GACCCAGGAGAGCTGCAACAGGG - Intronic
1183619310 22:38963522-38963544 GACCCAGGACAGGCCCAGTCGGG + Intronic
1183624457 22:38993117-38993139 GACCCAGGACAGACCCAGTCGGG + Intergenic
1183640201 22:39088133-39088155 GACCCAGGACAGGCCCAGTCAGG + Intergenic
1184195933 22:42927994-42928016 GTGCCATGACATCCCCAACCTGG - Intronic
1184660433 22:45963171-45963193 GAGCCAGGCCAGCCCCACACAGG + Intronic
949924637 3:9031491-9031513 GACCCTGGGCAGTCCCAACTTGG + Intronic
950354869 3:12398667-12398689 GACCCAGAACAGCAGGAACCAGG + Intronic
950625610 3:14244521-14244543 GACGCAGCACAGCCCCTAACAGG + Intergenic
953015186 3:39067901-39067923 GTACCATGACAGCCCCAACAGGG - Intronic
953268476 3:41416391-41416413 GACCCAGGAGAGTCCCTGCCAGG - Intronic
954298843 3:49688674-49688696 GACCCACCACAGCCCCATCCGGG + Exonic
954615548 3:51967325-51967347 GCCGCAGGACAGCCCCAGCGAGG - Exonic
955260017 3:57378951-57378973 CACCCACACCAGCCCCAACCAGG + Intronic
958768146 3:98395534-98395556 GTCAGAGCACAGCCCCAACCTGG + Intergenic
958889575 3:99768681-99768703 GTCCAAGGACTGCACCAACCTGG - Intronic
965111629 3:164432222-164432244 TAACCAGGTCAGACCCAACCAGG - Intergenic
968799568 4:2733240-2733262 GGCCCAGGGCACCCCCACCCAGG + Intergenic
968959489 4:3735663-3735685 GACCGAGGACACCCCCAGCCTGG - Intergenic
969296186 4:6271655-6271677 GAGCCAGGAGAGACCCAACTGGG - Intronic
969619754 4:8273128-8273150 GACCCAGGCCAGGCCCAGCCGGG - Intronic
971938974 4:33189426-33189448 GTCACAGGCCAGCCCCATCCTGG + Intergenic
972583788 4:40418549-40418571 GACCCAGCACACCCCCAGCAAGG + Intergenic
973369658 4:49235152-49235174 CACCCAGGACAACCCCATCAGGG - Intergenic
973391373 4:49560264-49560286 CACCCAGGACAACCCCATCAGGG + Intergenic
973741123 4:53920361-53920383 GCCCCAGGAAAGGGCCAACCCGG + Intronic
975747674 4:77490795-77490817 TACCCAGGACAGCCTGAAACAGG - Intergenic
980929108 4:139168641-139168663 AACCCAGGACAGGTCCATCCTGG + Intronic
981018573 4:140001508-140001530 GACCCAGGACAGGGCCAGCTCGG - Intronic
986343813 5:6815923-6815945 CATCCATGACAGCCCCAAGCGGG - Intergenic
986729925 5:10627892-10627914 GAGCCAGGCAAGCCCCAAGCTGG - Intronic
988442740 5:31250603-31250625 GACTCTACACAGCCCCAACCTGG + Intronic
988633890 5:32960586-32960608 GAACCAGGACAACCCAAAGCTGG + Intergenic
992509162 5:77416411-77416433 GACCCAGGACAGCCCCAACCTGG - Intronic
995748980 5:115434120-115434142 GACCCAGGACTTTCCCAACTGGG + Intergenic
996957060 5:129196035-129196057 GACCCCACACAGCCCTAACCAGG + Intergenic
997577928 5:134997157-134997179 AACCCAGACCAGCCCCCACCTGG - Intronic
1002164898 5:177338068-177338090 GCCACAGGACAGCCCTACCCAGG + Intronic
1006799002 6:36747774-36747796 AAGCCAGGGCAGCCCCAGCCAGG + Intronic
1013169056 6:107619801-107619823 TACCCAGGACAGCCTCAGTCTGG - Intronic
1013398489 6:109768163-109768185 GACCCAGGCCAACCCCATGCTGG - Intronic
1015274677 6:131371997-131372019 GATCCAGGCCACCCCCAACTGGG - Intergenic
1017321960 6:153104956-153104978 GAGCCAGGACATTCACAACCAGG - Intronic
1018067023 6:160131513-160131535 GCCTCAGGACAGCCCCAAACCGG - Intronic
1018979100 6:168588645-168588667 GTCTCAGTTCAGCCCCAACCTGG - Intronic
1019302962 7:318181-318203 GCCCCAGGCCAGGCCCAGCCAGG + Intergenic
1019386233 7:757764-757786 GACACAGGGCTGCCCCCACCAGG + Intronic
1021760102 7:23895365-23895387 AACCCAGCACAGCCACATCCTGG + Intergenic
1022201769 7:28124020-28124042 GACACAAGTCAGCCCCAAACAGG - Intronic
1023090060 7:36609071-36609093 GCCCAAGGTCAACCCCAACCCGG + Intronic
1025281614 7:57629761-57629783 GACCCAGCAGAGCCCGAGCCCGG - Intergenic
1025303116 7:57835754-57835776 GACCCAGCAGAGCCCGAGCCCGG + Intergenic
1027193290 7:76010560-76010582 GACCCAGCTCAGCCTCACCCTGG - Intronic
1030517287 7:110553772-110553794 GACCCAGAGCAGACCCAACAAGG - Intergenic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1034199622 7:149275762-149275784 GGCCTAGGACTGCCCCAACTAGG + Intronic
1034262235 7:149764419-149764441 GACCCAGCGCGGCCTCAACCAGG - Exonic
1034965702 7:155389334-155389356 TAGCCAGGGCAGCACCAACCTGG - Intronic
1041225033 8:55689570-55689592 GACCCAGGCCAGCACCACTCAGG + Intergenic
1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG + Intergenic
1049182628 8:141230886-141230908 GAACCAGGCCTGCCCCACCCGGG + Intronic
1049225683 8:141449471-141449493 CACCCAGTCCAGCCCCAGCCTGG - Intergenic
1057504928 9:95626224-95626246 GCCCCAGGACAGCCCACCCCGGG - Intergenic
1058884926 9:109315676-109315698 GACCCTGGACAGCACCTCCCCGG - Intronic
1060995252 9:127872166-127872188 GACCCAGGACAGCACCTGGCTGG - Intronic
1061078992 9:128358871-128358893 GCCCCAGGGCACCCCCAAGCAGG + Intronic
1061327714 9:129874280-129874302 GAGCCACCACAGCCCCAACCTGG - Intronic
1061482242 9:130902991-130903013 GACCCAGGCCAGGCCCGGCCCGG - Exonic
1061792200 9:133064689-133064711 CACCCAGGACAGCACCTACGGGG + Exonic
1062031890 9:134365536-134365558 GCCCCAGTGCAGCCCCAGCCTGG - Intronic
1062580076 9:137225525-137225547 GGCCCAGGAAAGCCCCCACCAGG - Intronic
1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG + Intergenic
1185750841 X:2608965-2608987 GCCCCAGGGCGGCCCCTACCTGG - Intergenic
1190214546 X:48470755-48470777 GACCCATCACAGCCCCATCAAGG + Intergenic
1190928074 X:54926410-54926432 GACCAAGGACACACCCAAGCTGG + Exonic
1199808536 X:151326738-151326760 GACCTAGGAGAGCTCCAAGCTGG - Intergenic
1201783242 Y:17745553-17745575 GGCTCAGGACAGGCCCAAGCAGG - Intergenic
1201818311 Y:18160434-18160456 GGCTCAGGACAGGCCCAAGCAGG + Intergenic