ID: 992509981

View in Genome Browser
Species Human (GRCh38)
Location 5:77423049-77423071
Sequence GTACACACAGTGGCAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992509981_992509986 22 Left 992509981 5:77423049-77423071 CCAGTTTCTGCCACTGTGTGTAC 0: 1
1: 0
2: 2
3: 25
4: 226
Right 992509986 5:77423094-77423116 AAGAAAGAACATGTAGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992509981 Original CRISPR GTACACACAGTGGCAGAAAC TGG (reversed) Intronic
900354884 1:2256133-2256155 GGACACAGAGTGGCACAGACTGG - Intronic
900918100 1:5652382-5652404 GTACTCACAGAGGCAGGAACCGG + Intergenic
900986855 1:6078174-6078196 GTATCCACAGGGGCAGAGACTGG - Intronic
901016069 1:6231571-6231593 AAACAAACAGAGGCAGAAACAGG + Intronic
901023694 1:6268043-6268065 ATATACACAGAGGCAGAAAGTGG + Intronic
901285299 1:8073825-8073847 ATACACAGAGAGGCAGACACAGG - Intergenic
902765190 1:18609705-18609727 AAACTCAAAGTGGCAGAAACGGG + Intergenic
903607298 1:24584319-24584341 GCACACACAGTGCCAGAAGTCGG - Intronic
903695862 1:25206458-25206480 GGACACACTGAGGCAGACACAGG + Intergenic
903704756 1:25277567-25277589 GTAGAAACAGAGGCAGAAAGAGG - Intronic
903722476 1:25415757-25415779 GTAGAAACAGAGGCAGAAAGAGG + Intronic
904889788 1:33771182-33771204 GTACACACAGTGGGAGCCCCAGG - Intronic
905008970 1:34733925-34733947 GGGAACACAGTGGCTGAAACAGG + Intronic
905076959 1:35280706-35280728 GTAAAGACAGAGGCAAAAACTGG - Intronic
905825037 1:41020786-41020808 GTACACAGATTGGCAGAGACTGG + Exonic
906253152 1:44326985-44327007 GTACATACAGAGGGAGACACAGG - Intronic
907557751 1:55359411-55359433 TGAGACACAGTGGCAGAGACTGG + Intergenic
907830199 1:58057543-58057565 GTAAAGACAGGGGCAGAAACTGG + Intronic
910752859 1:90653239-90653261 ACACACACAGTGGGAGAAAGTGG + Intergenic
913170769 1:116230115-116230137 GTAAAGACAGAGGCAGAAATGGG - Intergenic
914360434 1:146931300-146931322 GAACACACAGCAGCAGAACCTGG - Intergenic
914493313 1:148168598-148168620 GAACACACAGCAGCAGAACCTGG + Intergenic
915804576 1:158830996-158831018 GTTCACAGAGTGGCAGGAGCAGG - Intergenic
918101908 1:181383678-181383700 GAATATACTGTGGCAGAAACTGG + Intergenic
918636715 1:186783443-186783465 CTACATACAGTGCTAGAAACAGG + Intergenic
920633776 1:207678897-207678919 GGACAGACAGAGACAGAAACTGG - Intronic
921816409 1:219569033-219569055 GTACACACAGTGACACAACCAGG + Intergenic
922781452 1:228256298-228256320 GTCCTGACAGTGGCAGAAGCGGG + Intronic
1062858511 10:791749-791771 GTACACACACTGGCAGACACAGG - Intergenic
1068577490 10:58700461-58700483 GTAAACACATTAGCAGAGACAGG + Intronic
1068712637 10:60150957-60150979 GTTCACACAGTTACAGAAACTGG - Intronic
1068892325 10:62160740-62160762 GTACAGACAGAGACAGAGACTGG + Intergenic
1069608768 10:69758204-69758226 GCACACACAGTGCCAGACACTGG - Intergenic
1072231038 10:93414182-93414204 GACCACACAGAGGCAGAGACTGG - Intronic
1073206477 10:101772066-101772088 GAACCCAAAGTGGCAGAAACAGG - Intronic
1073242167 10:102065944-102065966 GCACACACAGTGGCTGAAAGCGG - Exonic
1075542383 10:123325712-123325734 GTTCACACTGTTGCAGAACCAGG - Intergenic
1076551174 10:131278950-131278972 GCACACACAGTGGCAGCAGAAGG - Intronic
1077298651 11:1837509-1837531 GGACACACAGTGGCAGGAGAAGG - Exonic
1077728582 11:4703463-4703485 CTACACACAGCTGCAGAAAATGG - Intergenic
1077753129 11:4995898-4995920 GTACACACAGAAATAGAAACGGG + Intergenic
1078040745 11:7860600-7860622 GTTCACACAGTGGTATAAATGGG + Intergenic
1078439013 11:11348710-11348732 GTAAAGAGAGTGGCAGAAAGAGG - Intronic
1079669463 11:23149273-23149295 TTACACAAAGTAGCACAAACTGG + Intergenic
1081311692 11:41582141-41582163 GTGAACACAGAGGCAGAAACGGG - Intergenic
1082082420 11:48022556-48022578 GGACATACAGTGTTAGAAACAGG - Intronic
1083085900 11:60145082-60145104 GGAGGCACAGTGGCTGAAACTGG + Intergenic
1084980116 11:72824523-72824545 GAGCACACAGAGGCAGACACAGG - Intronic
1087515567 11:99154959-99154981 GTCCAGACAGTAGCAGAATCAGG + Intronic
1088085497 11:105973981-105974003 TTACATAGAGTGGCAGAAATGGG - Intronic
1089624403 11:119742266-119742288 GCACACACAGAGGCACACACAGG + Intergenic
1090183551 11:124721242-124721264 GAAAACACAGTGGAAGAAAAGGG - Intergenic
1090648199 11:128783467-128783489 GGAAAAACAGTGGCAGAAACAGG - Intronic
1091363138 11:134994035-134994057 GTACACACAGTGACAAAAAAAGG + Intergenic
1092348708 12:7738381-7738403 GTGCTGACAGTGGAAGAAACTGG - Intronic
1094800477 12:34027910-34027932 GTGAACACAGAGGCAGAGACTGG - Exonic
1095591966 12:43913647-43913669 TGTCACACAGTGGCAAAAACAGG - Intronic
1097374912 12:58830735-58830757 GTAACCACAGAGGCAGAGACTGG - Intergenic
1097419459 12:59356441-59356463 GAATCCACAGTTGCAGAAACAGG + Intergenic
1098148239 12:67519632-67519654 GCACACACATTGGCATAAGCAGG + Intergenic
1098324022 12:69281408-69281430 GAACACCCAGTGGCAAGAACTGG - Intergenic
1100632406 12:96401244-96401266 GTAAAAACAGTTGCAGAAACTGG - Intergenic
1100799172 12:98213339-98213361 GTGAACACAGGGGCAGTAACTGG - Intergenic
1101370450 12:104124250-104124272 GGATACACAGTGTCAGATACAGG + Intronic
1103687446 12:122743227-122743249 GTGAACACAGAGGCAGATACTGG - Intergenic
1104514605 12:129413026-129413048 TGACTCTCAGTGGCAGAAACTGG - Intronic
1105007450 12:132730062-132730084 GTCCACACAGCAGCAGAAATGGG - Exonic
1106886439 13:34189989-34190011 CTACACACAGCTGCAAAAACTGG - Intergenic
1109671273 13:65611697-65611719 GTACACACTGAGTCTGAAACAGG + Intergenic
1110857450 13:80312081-80312103 TTACACAGAGTGGCAGAATCAGG + Intergenic
1114256001 14:21001828-21001850 TTACACACAGTAGCATAAATGGG - Exonic
1114895431 14:26984229-26984251 GGAGACACAGTGGCAGAGCCAGG + Intergenic
1116300575 14:43176129-43176151 GTACACACTGAGTCTGAAACAGG + Intergenic
1117260208 14:54024873-54024895 GAACACACAGTGGTGAAAACTGG - Intergenic
1117789540 14:59325137-59325159 GTACACACAGTGGTTAGAACAGG - Intronic
1117916974 14:60687972-60687994 GTACAGAGAGGAGCAGAAACTGG + Intergenic
1118600083 14:67465878-67465900 GTGACCACAGTGGCAGAAATGGG + Intronic
1118932096 14:70252392-70252414 GCACACACAGTGCCAAAAATTGG + Intergenic
1119648660 14:76367589-76367611 GTACACAGAGTGGGAGAAAGAGG + Intronic
1119742024 14:77019994-77020016 GGTCACACAGTGGCAGAGTCTGG - Intergenic
1121671252 14:95712229-95712251 GTACACTAAGCGCCAGAAACTGG + Exonic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1122741573 14:103874647-103874669 GAACACTCAGTGGGAGAAGCAGG + Intergenic
1124799114 15:32812215-32812237 TTACACACAATGGCAGAGATAGG + Intronic
1128224476 15:65992424-65992446 ACACACACAGAGGCACAAACGGG - Intronic
1129513344 15:76140730-76140752 GGTCACACAGTGACAGAGACGGG + Intronic
1131805343 15:96116154-96116176 GAAAACAAAGTGACAGAAACAGG + Intergenic
1133407179 16:5534082-5534104 GTGCACAAAGCGGCAGCAACTGG - Intergenic
1133413279 16:5586081-5586103 GTAGAAACAGAGGCAGAGACGGG + Intergenic
1135396431 16:22135306-22135328 GTAAAGACAGAGGCAGAGACTGG - Intronic
1135827342 16:25740779-25740801 GGTCACACAGTGCCAGAACCAGG + Intronic
1135827433 16:25741839-25741861 GGCCACACAGTGCCAGAACCAGG + Intronic
1136271068 16:29148574-29148596 GTTCACACCGAGGCAGAGACAGG - Intergenic
1136628973 16:31478167-31478189 GTACAGATAGTGGCAGAGCCAGG + Intergenic
1137567432 16:49542317-49542339 GGACACTCAGTGGCAGAGCCCGG - Intronic
1138358381 16:56404739-56404761 TTACACCCAGTGGCAAAAAGAGG + Intronic
1138468030 16:57208089-57208111 TTACACGAAATGGCAGAAACAGG + Exonic
1140133922 16:72188568-72188590 GTACACACAGAGAAGGAAACAGG + Intergenic
1142074681 16:88110579-88110601 GTTCACACTGAGGCAGAGACGGG - Intronic
1142893634 17:2960803-2960825 GTACACAAACTAGAAGAAACAGG - Intronic
1144175707 17:12704965-12704987 GTAGACACAGTGGAAGAAGAAGG - Intronic
1148504666 17:48117869-48117891 GTGCACACAGTGGCACGTACCGG + Intronic
1150589123 17:66546543-66546565 GTGAACACAGAGGCGGAAACTGG - Intronic
1150616259 17:66774731-66774753 TTACACACATTGGCAGCAGCTGG - Intronic
1151766398 17:76135541-76135563 ACACACACAGGGGCACAAACAGG - Intergenic
1152388064 17:79986914-79986936 GTAAACACAGCAGCAGAGACCGG - Intronic
1152839086 17:82555068-82555090 GAACACACAGTGCCAGGAATTGG + Intronic
1156338736 18:36191357-36191379 GTAGACACAGTGGCTGCAGCTGG - Intronic
1157031415 18:43913320-43913342 TTACACACAGTGGAAGATCCAGG - Intergenic
1159959541 18:74544975-74544997 GCACACACGGAGGCAGAGACTGG + Intronic
1160483148 18:79261437-79261459 GTGAAGACAGTGGCAGAAACTGG + Intronic
1166121267 19:40688555-40688577 ATACACACAGAGACAAAAACAGG + Intronic
1166931252 19:46302934-46302956 TTGAAGACAGTGGCAGAAACAGG + Intronic
1167781104 19:51599478-51599500 GTACACACATTGGCAGGTAGAGG + Intergenic
1168333267 19:55581541-55581563 GGAGTCACAGTGGCAAAAACCGG + Intergenic
927070732 2:19526657-19526679 CAGCACACAGAGGCAGAAACAGG - Intergenic
927213640 2:20653554-20653576 GGACCCACAGAGGCAGAAAATGG - Intergenic
929561467 2:42959074-42959096 GTACACCCAGAGGCAGATACAGG - Intergenic
932698629 2:73977921-73977943 GTACACACAGGAGCTGAAAATGG + Intergenic
932982663 2:76688714-76688736 CTACACACAGTGCCACACACTGG + Intergenic
932985377 2:76720338-76720360 GGACACACACTGCAAGAAACTGG - Intergenic
933090474 2:78110753-78110775 GTCCCCACAGTGGAAGAAAAAGG - Intergenic
934773313 2:96921636-96921658 GGGCACACAGCGCCAGAAACTGG + Exonic
935966997 2:108489082-108489104 GTACTCATTGTGGCAGAATCAGG + Intronic
938140747 2:128793035-128793057 GCACACACAGTGCCACACACAGG + Intergenic
938202539 2:129387172-129387194 CTACCCACAGTGGAAGCAACAGG - Intergenic
941188601 2:162347617-162347639 GGACAGCCAGTGCCAGAAACAGG + Exonic
942176430 2:173339093-173339115 GTGAATACAGAGGCAGAAACTGG + Intergenic
944540706 2:200750795-200750817 GAGCACACAGTGGCAGAACTAGG - Intergenic
945195961 2:207237934-207237956 GTGAACACAGTGACAGACACTGG + Intergenic
946650445 2:221887517-221887539 CTTCACACAGTGGCAGAGAATGG - Intergenic
948714587 2:239852479-239852501 GGACACAGTGTGGCAGAAGCAGG + Intergenic
949010916 2:241677845-241677867 GAGGACACAGTGGCAGGAACAGG + Intronic
1168736632 20:145672-145694 GTTCAACCAGTGGGAGAAACGGG - Exonic
1171297846 20:24034418-24034440 CTACCCACTGTGGCAGAATCTGG + Intergenic
1171769105 20:29308010-29308032 ATAGACACAGTGAGAGAAACAGG + Intergenic
1174566674 20:51469711-51469733 GTGCAGACAGAGGCAGAGACTGG + Intronic
1178056186 21:28801062-28801084 GAACACACTGTGGAAGAAACAGG + Intergenic
1178175073 21:30087366-30087388 GTGAAGCCAGTGGCAGAAACTGG - Intergenic
1179931305 21:44572637-44572659 GCAGACACAATGGCAGAACCTGG - Intronic
1180039220 21:45267272-45267294 GGGCAGACAGGGGCAGAAACCGG + Intronic
1181604412 22:23971690-23971712 GTACCCACAGTGGGAGTACCTGG - Exonic
1182821751 22:33222624-33222646 GTGAAGACAGAGGCAGAAACTGG + Intronic
1183483270 22:38076222-38076244 GTCTGCAGAGTGGCAGAAACAGG + Intergenic
1184987940 22:48148051-48148073 GGACAGACAGGGACAGAAACTGG + Intergenic
949627944 3:5888841-5888863 GTACCCAAAGGTGCAGAAACTGG + Intergenic
949779332 3:7668365-7668387 CCACCCACAGTGGCAGACACTGG + Intronic
950420590 3:12896452-12896474 GGACGCCCAGTTGCAGAAACAGG + Intergenic
950535081 3:13573974-13573996 GTGGACACAGGGGCAGAAAGTGG - Intronic
951398703 3:22203398-22203420 GTACACACAGTGGGCTATACCGG + Intronic
952078740 3:29731234-29731256 GTAAGCACAGTGTCAGCAACTGG - Intronic
952608436 3:35178813-35178835 GTACCTACAGTGACAGAAGCAGG + Intergenic
952640196 3:35584469-35584491 GTAGACACAGTGCCAGAAAAAGG - Intergenic
952743677 3:36758520-36758542 CTTCACACAGTGGAAGGAACAGG - Intergenic
953043985 3:39279224-39279246 GTACAAAAAGTGGAAGAAAAAGG + Intronic
956038278 3:65119206-65119228 GTACACACAGAGGGAGGCACAGG - Intergenic
957872476 3:86107421-86107443 GCACAGAAAGTGGGAGAAACAGG - Intergenic
958813470 3:98890296-98890318 GTAACCACAGAGGCAGAGACTGG + Intronic
959679014 3:109071548-109071570 GGACACACAGTGGCTGACAAGGG + Intronic
959696658 3:109255550-109255572 GCATACACTGAGGCAGAAACTGG + Intergenic
960159356 3:114333323-114333345 CTACATACAGAGGCAGAAAAGGG - Intergenic
961432737 3:126894566-126894588 GCACACACAGAGGAAGAAATGGG - Intronic
962618023 3:137148181-137148203 GTAGACACAGTCCCAGAAACAGG + Intergenic
963985470 3:151588582-151588604 GTATACACCGTATCAGAAACTGG - Intergenic
965693947 3:171387399-171387421 TTACACACACTGGCAAACACTGG - Intronic
966669823 3:182514654-182514676 GAACAAACAGTGTCAGAATCAGG + Intergenic
968118270 3:196106333-196106355 ATACACATAGTTGCAGAAAAGGG + Intergenic
968271373 3:197406073-197406095 GGTCACACAGTGGCAGAGCCCGG - Intergenic
968475184 4:802081-802103 GTTCACACAATGGCAGGAACAGG + Intronic
969212597 4:5699168-5699190 GCAGAGACAGTGGCAGAGACAGG + Intronic
970566272 4:17335189-17335211 GTGCAGACAGAGGCAGAGACTGG + Intergenic
971041903 4:22763082-22763104 TTACGCACAGTAGCAGTAACAGG - Intergenic
972277777 4:37573384-37573406 GTTCCCACAGTGGCAGAATCAGG + Intronic
976897491 4:90128641-90128663 GTACACACGGTGCCAGCAAGGGG + Intronic
978441521 4:108739052-108739074 GTGGACACAGTGGCAGAGATGGG + Intergenic
978962109 4:114692684-114692706 ATACAGACAGTGGCAAGAACAGG - Intergenic
979115132 4:116814305-116814327 GTAAAGACAGAGGCAGAAATTGG - Intergenic
979531208 4:121770924-121770946 GTAGACACTGTGGCACAGACTGG + Intergenic
981283476 4:142988337-142988359 GAACACACAGAGGCTGAAATTGG - Intergenic
981788757 4:148511269-148511291 GTACACATAGTGACAGAGCCAGG + Intergenic
981917738 4:150052965-150052987 TTTCACACACTGGCAGCAACAGG - Intergenic
982756641 4:159227565-159227587 GTCTACACAGTGGCACAAACAGG - Intronic
984921189 4:184765919-184765941 GTCAGCACAGTGGCAGACACCGG + Exonic
985118954 4:186620244-186620266 ACAGAGACAGTGGCAGAAACGGG - Exonic
985225596 4:187758018-187758040 GTCTACACATTGGCAGAGACAGG + Intergenic
985251551 4:188029366-188029388 GTACACACACAGGCACACACGGG - Intergenic
985330210 4:188823659-188823681 GCACACACAGGGACACAAACGGG + Intergenic
986026707 5:3858119-3858141 GGACTCTCAGTGGCGGAAACAGG - Intergenic
986159997 5:5218937-5218959 GCACACACAGTGGCTGAACGTGG - Intronic
987036993 5:14029165-14029187 ATTCCCACAGTGGGAGAAACTGG - Intergenic
988054015 5:26069058-26069080 GTACCCACAGTGATAGAAACAGG + Intergenic
989594117 5:43140354-43140376 GGCCACACAGTGGTAGAAGCAGG - Intronic
991952752 5:71962699-71962721 TGACACACAATGGTAGAAACAGG + Intergenic
992509981 5:77423049-77423071 GTACACACAGTGGCAGAAACTGG - Intronic
993977139 5:94496483-94496505 TGACACACAAAGGCAGAAACTGG + Intronic
997434719 5:133866014-133866036 GTAAAGACAGAGGCAGAGACGGG + Intergenic
997593139 5:135087712-135087734 GTCCACAGACTGGCAGGAACAGG - Intronic
998153401 5:139770006-139770028 GTACACAGAGAGGTAGAACCTGG + Intergenic
998609473 5:143672276-143672298 GTAGACACAGGAGCTGAAACAGG - Intergenic
1000121009 5:158197898-158197920 GTACACACTGTGAGAGAAGCAGG + Intergenic
1002163894 5:177332886-177332908 GGAGGCAGAGTGGCAGAAACAGG - Intronic
1002835255 6:860311-860333 GTCCACACCTTGGCAGAACCAGG + Intergenic
1002896013 6:1380799-1380821 GTACACGCAGTGGCTGTAAACGG - Intergenic
1004148213 6:13089814-13089836 GTAACCACAGTGGAACAAACTGG + Intronic
1007742725 6:44022648-44022670 GTACTCACAGGGGCAGACAGAGG + Intergenic
1009459422 6:63894376-63894398 GTGAAGACAGAGGCAGAAACTGG + Intronic
1014289019 6:119536932-119536954 GTACCAACAGTGCCAGAGACAGG + Intergenic
1015178385 6:130336314-130336336 GGTCACACAGTGGCAGAGCCAGG + Intronic
1015265530 6:131288352-131288374 GTACACACATTATCAGGAACTGG + Intergenic
1015777486 6:136829187-136829209 GAACAGACTGAGGCAGAAACTGG - Intronic
1016902727 6:149118027-149118049 GTATCCACAGTGGCAGAAACAGG + Intergenic
1018310814 6:162506576-162506598 ATAAACACAGGGGCAGTAACTGG + Intronic
1019645870 7:2128698-2128720 GGACACAGAGGGGCTGAAACCGG + Intronic
1020125853 7:5532168-5532190 CAGCACACAGTGGCAGACACAGG + Intronic
1022630175 7:32077341-32077363 GGACACAAAGGGACAGAAACTGG + Intronic
1022637019 7:32145820-32145842 GCACACAAAGTGGCAGAGGCAGG + Intronic
1023223423 7:37944539-37944561 GGACTCACAGTGGCAGAAGAAGG + Intronic
1023873441 7:44274774-44274796 GTGCCCACACTGGCAGAACCAGG + Intronic
1027199402 7:76053702-76053724 GCAAACAAAGTGGCAGACACGGG - Intronic
1027814754 7:82954081-82954103 GTAGAAACAGTGTCAGCAACTGG + Exonic
1029635710 7:101782342-101782364 GTACCCACTGTGCAAGAAACAGG - Intergenic
1030033051 7:105386889-105386911 CAATACACAGTGGGAGAAACTGG + Intronic
1031970781 7:128063401-128063423 GGACCCAGAGGGGCAGAAACTGG - Intronic
1032114812 7:129107930-129107952 GGACACACAGAGACAGACACAGG - Intergenic
1032300369 7:130680827-130680849 GTACGCACAGTCACAGAAGCTGG + Intronic
1033823221 7:145158996-145159018 TTACTCACAGTGGCAGAAGCAGG - Intergenic
1035578791 8:726706-726728 GTACACACACAGGCACACACAGG + Intronic
1035909679 8:3551979-3552001 GATCTCACAGTGGCAGAAACAGG + Intronic
1036795240 8:11751172-11751194 ATACACACAGTATCAGAAAAAGG + Intronic
1039288267 8:36066403-36066425 GTAGAGCCAGTGGCAGTAACAGG - Intergenic
1040786937 8:51177165-51177187 GTACACACAGACACAGAAAGTGG + Intergenic
1040889505 8:52302151-52302173 GTGGACGCAGTGGCAGAGACTGG + Intronic
1045747829 8:105444320-105444342 GGACACACAGTCAGAGAAACCGG + Exonic
1047717758 8:127611296-127611318 AGACACACAGAGGCAGAGACTGG + Intergenic
1047808557 8:128383095-128383117 GGACACAAAGTGGCACAAAGAGG + Intergenic
1049050441 8:140190573-140190595 GTACACCCAGAGGCAGAGCCTGG + Intronic
1050044447 9:1528327-1528349 GTGACCACAGTGGCAGAAATGGG - Intergenic
1050621746 9:7460461-7460483 CTAGACACATTGTCAGAAACTGG + Intergenic
1051033285 9:12709850-12709872 GGAAACACAGTGGCAAACACAGG - Exonic
1052233135 9:26178849-26178871 GTAAACACATTTCCAGAAACTGG - Intergenic
1052769232 9:32672132-32672154 GTACACACATTGGCATTACCTGG - Intergenic
1057833569 9:98426377-98426399 ATACACACACTGGCAGATGCAGG - Intronic
1058135730 9:101305752-101305774 GTAGAAACAGTGACAGAACCAGG - Intronic
1059645772 9:116265365-116265387 GTACACACAGCATCAGAAAAGGG + Intronic
1060734973 9:126061160-126061182 ATACACACACAGGCAGACACAGG + Intergenic
1060989556 9:127840570-127840592 GAACACAGAGTAGCAGAACCTGG - Intronic
1188599239 X:31941109-31941131 GTCTACACAGTTGCTGAAACAGG + Intronic
1189597292 X:42582903-42582925 GTTCACAAAGAAGCAGAAACAGG + Intergenic
1194819171 X:98485022-98485044 GTAAAGATAGTGGCAGAAGCTGG + Intergenic
1195177473 X:102324798-102324820 GTGCAAACACTGGCAGAAAATGG + Intronic
1195181391 X:102362295-102362317 GTGCAAACACTGGCAGAAAATGG - Intronic
1201985071 Y:19957109-19957131 ATACACACACTGGCAGAGATGGG - Intergenic
1202379835 Y:24266904-24266926 GCAGACACAGTGGCTGAACCAGG + Intergenic
1202490947 Y:25403217-25403239 GCAGACACAGTGGCTGAACCAGG - Intergenic