ID: 992510420

View in Genome Browser
Species Human (GRCh38)
Location 5:77427490-77427512
Sequence TATTACGTATAGATGGTGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992510420_992510428 -5 Left 992510420 5:77427490-77427512 CCATGCACCATCTATACGTAATA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 992510428 5:77427508-77427530 TAATATTTTGGGAGGGGATAGGG 0: 1
1: 0
2: 4
3: 36
4: 311
992510420_992510430 7 Left 992510420 5:77427490-77427512 CCATGCACCATCTATACGTAATA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 992510430 5:77427520-77427542 AGGGGATAGGGGAAGTTTCAAGG 0: 1
1: 0
2: 1
3: 30
4: 278
992510420_992510427 -6 Left 992510420 5:77427490-77427512 CCATGCACCATCTATACGTAATA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 992510427 5:77427507-77427529 GTAATATTTTGGGAGGGGATAGG 0: 1
1: 0
2: 3
3: 22
4: 238
992510420_992510429 -4 Left 992510420 5:77427490-77427512 CCATGCACCATCTATACGTAATA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 992510429 5:77427509-77427531 AATATTTTGGGAGGGGATAGGGG 0: 1
1: 0
2: 1
3: 48
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992510420 Original CRISPR TATTACGTATAGATGGTGCA TGG (reversed) Exonic
907882541 1:58564791-58564813 TATGACGTTTACATAGTGCACGG - Intergenic
907998916 1:59661287-59661309 TATTGCACATACATGGTGCATGG - Intronic
909261623 1:73496603-73496625 TCTTACCTAGGGATGGTGCATGG - Intergenic
911435461 1:97851397-97851419 TAATACATATAGTTGGTGAAAGG - Intronic
912033465 1:105280405-105280427 TATTAAGAATAGATTGTGGATGG + Intergenic
919380502 1:196854673-196854695 TATTACGAATAAATAGAGCATGG + Intronic
1065711427 10:28521956-28521978 TCTGAGTTATAGATGGTGCAGGG + Intergenic
1070406020 10:76096283-76096305 TATTACTTGTATATGGTGCCAGG + Intronic
1073681427 10:105708405-105708427 TTTTACAAATTGATGGTGCATGG + Intergenic
1075904926 10:126072786-126072808 TATTACTTAGAGAGGGAGCAGGG + Intronic
1079715562 11:23739324-23739346 TATTGCTTAGAGATGGTGCATGG + Intergenic
1086766268 11:90699222-90699244 TATTACATGTAGAAGCTGCAGGG - Intergenic
1093016286 12:14157733-14157755 TGTTACGTATAGATGATGTCTGG + Intergenic
1103639169 12:122335309-122335331 GATTATGAAAAGATGGTGCAGGG + Intronic
1107220701 13:37976077-37976099 TATTTCTTAAAGATGGTGAATGG - Intergenic
1109081266 13:57904290-57904312 GATTTCTTATAGATGGTGTAAGG - Intergenic
1109247488 13:59973827-59973849 TTTTATGTGTAGAGGGTGCATGG + Intronic
1111167509 13:84479565-84479587 TCTTACTTATAGAATGTGCAGGG - Intergenic
1112470181 13:99681349-99681371 TATAACTTACAGATGGTTCACGG + Intronic
1127152420 15:56090295-56090317 TATTACCAATGAATGGTGCATGG - Exonic
1129124791 15:73430235-73430257 TATTATGTTTAAATGGTGTATGG - Intergenic
1130825144 15:87536439-87536461 AAATATGTATAGATGGTGAAGGG - Intergenic
1143955792 17:10667837-10667859 GATTACTTATAGAGGGTGAATGG + Intergenic
1149060523 17:52416036-52416058 TATTACTTTAAGATGCTGCAGGG + Intergenic
1152314113 17:79570253-79570275 AATTACGGACAGATGGTGAATGG + Intergenic
1152314126 17:79570332-79570354 GATTACAGATAGATGGTGGATGG + Intergenic
1156049290 18:32912838-32912860 TATTAGGTATTGAGGGTTCAGGG + Intergenic
1159183374 18:64939773-64939795 TATTTTATAAAGATGGTGCATGG - Intergenic
1160135414 18:76267113-76267135 TTTGACCTATAGAAGGTGCATGG - Intergenic
1160961828 19:1725592-1725614 TATTACGGAGAGATGGGGCGGGG + Intergenic
1167719115 19:51166597-51166619 TTTTACGTGAAGATGCTGCATGG + Intergenic
926764519 2:16312613-16312635 TATCACGTAGAGATGAAGCAGGG + Intergenic
928414641 2:31082094-31082116 TATTACTTATAGTTGGTGCGTGG - Intronic
930630184 2:53745200-53745222 TATTATGTGTATATGGAGCAAGG + Intronic
935409957 2:102751302-102751324 TATGACGTTTACATAGTGCACGG + Intronic
938004368 2:127775952-127775974 TATAAGGTATAGATGGAGCCTGG - Intronic
940730346 2:157382521-157382543 TATTAGGCACACATGGTGCATGG - Intergenic
944121130 2:196242038-196242060 CATAATGTATAGATGGTGAAAGG - Intronic
1184570350 22:45319674-45319696 TATTATTAATAGATGGTGGAGGG + Intronic
952158486 3:30669557-30669579 TATGACGTTTACATAGTGCATGG + Intronic
952733619 3:36665954-36665976 TCTTACATATAGAGAGTGCATGG - Intergenic
959336609 3:105074686-105074708 TATTACATCTAGATGGAGCTTGG - Intergenic
960163500 3:114376161-114376183 TAATACGTATAGATGGTTTTGGG + Intronic
964577590 3:158191517-158191539 TTTTATGTAGAGATGTTGCAGGG + Intronic
965029276 3:163342404-163342426 TATGACGTTTACATAGTGCATGG - Intergenic
975127310 4:70797358-70797380 TATTACGAAAAGACTGTGCATGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
979718074 4:123865837-123865859 TATCACTTATTGATGGTGTAGGG + Intergenic
992510420 5:77427490-77427512 TATTACGTATAGATGGTGCATGG - Exonic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
996356194 5:122598760-122598782 TATTTCCTAAAGATGGTGCTAGG - Intergenic
999324622 5:150636184-150636206 AAATATGTATAGGTGGTGCATGG - Intronic
999968618 5:156836209-156836231 TAATAGGTATAGAGGGTGAATGG - Intergenic
1005182026 6:23116560-23116582 TATGACGTTTACATAGTGCATGG + Intergenic
1011504398 6:88025805-88025827 TATTACATAAATATGGTCCAGGG + Intergenic
1012751781 6:103173421-103173443 TATTACGAATATATGTGGCAGGG - Intergenic
1013969573 6:116000864-116000886 TATTACTTTTAGAAGTTGCATGG - Intronic
1018935300 6:168270134-168270156 TATTATGTATATATGGTGTGGGG - Intergenic
1022593429 7:31688164-31688186 TATTACCCATAGAATGTGCATGG - Intronic
1031173642 7:118321652-118321674 TATTACGTTTACAATGTGCAAGG - Intergenic
1033806051 7:144955271-144955293 TATTAGGTATGGATGGGGCCTGG + Intergenic
1034910549 7:154994521-154994543 TTTTATGCAGAGATGGTGCAAGG + Intronic
1038072498 8:24032786-24032808 TATTAAGTATAGATGGAGACAGG - Intergenic
1039183302 8:34890438-34890460 TATGACGTTTATATAGTGCATGG - Intergenic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1044458835 8:92420719-92420741 TATTGAGTATAGATGATGTAAGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1051171238 9:14319719-14319741 TATTAAGTATAAAAAGTGCATGG + Intronic
1051699796 9:19809718-19809740 TATGACGTTTACATAGTGCAGGG - Intergenic
1053099202 9:35355595-35355617 TATTAAGAATAGAAAGTGCAAGG - Intronic
1054789514 9:69242595-69242617 TCTTCAGGATAGATGGTGCAGGG + Intronic
1055817851 9:80228930-80228952 TATTAGGTCCAGTTGGTGCAGGG + Intergenic
1057065071 9:92041657-92041679 TGTTACGTAAAGTTGGTACAAGG + Intronic
1187754098 X:22501251-22501273 TATTACATATTTATGGGGCACGG - Intergenic
1187811152 X:23178977-23178999 TATTATGTGTACATGGTGCACGG + Intergenic
1192618978 X:72657712-72657734 TGGTACATATAGATGTTGCAAGG - Intronic