ID: 992519857

View in Genome Browser
Species Human (GRCh38)
Location 5:77539436-77539458
Sequence CAGTAGGTCTGGGGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992519850_992519857 11 Left 992519850 5:77539402-77539424 CCTGGCAGATCTTGTTAAAATGT 0: 1
1: 1
2: 3
3: 48
4: 366
Right 992519857 5:77539436-77539458 CAGTAGGTCTGGGGTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992519857 Original CRISPR CAGTAGGTCTGGGGTGGAGT GGG Intronic
No off target data available for this crispr