ID: 992524157

View in Genome Browser
Species Human (GRCh38)
Location 5:77590428-77590450
Sequence GGGACCACACAGATGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992524150_992524157 5 Left 992524150 5:77590400-77590422 CCAGAAGGAGGGATACAGCTTGC 0: 1
1: 0
2: 0
3: 10
4: 109
Right 992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG No data
992524149_992524157 6 Left 992524149 5:77590399-77590421 CCCAGAAGGAGGGATACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 146
Right 992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992524157 Original CRISPR GGGACCACACAGATGGCACA TGG Intronic
No off target data available for this crispr