ID: 992524378

View in Genome Browser
Species Human (GRCh38)
Location 5:77593358-77593380
Sequence TAGACTATAAGCAGCAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992524378 Original CRISPR TAGACTATAAGCAGCAAGAG TGG Intronic
901159299 1:7162979-7163001 TAGATTGTAGGCAGCAAGCGGGG + Intronic
904297126 1:29527160-29527182 GAGACTACAGGCAGCAAGGGAGG + Intergenic
904337044 1:29804691-29804713 GAGATTATAATCAGCAAGGGAGG + Intergenic
906959478 1:50408584-50408606 TTGAATATAAGCAGCAAGACTGG - Intergenic
909260407 1:73481626-73481648 TAGATTATAAGCAACCAGATTGG + Intergenic
909406692 1:75298194-75298216 TGGACTAAAAGAAGCATGAGGGG - Intronic
909834877 1:80241351-80241373 TAAATTATAAACAGAAAGAGAGG - Intergenic
912434157 1:109647483-109647505 TTGACTAGAAGTGGCAAGAGCGG + Intergenic
913457669 1:119049915-119049937 TAGACTGTAGGGAGCTAGAGTGG - Intronic
915764140 1:158346362-158346384 TTGAATAGAAGTAGCAAGAGTGG + Intergenic
916330592 1:163611901-163611923 AAGATTAGAAGCAGCAATAGAGG + Intergenic
916403157 1:164470454-164470476 TAGAGAATAAGCAGTAAGAAGGG - Intergenic
918573445 1:186026433-186026455 TACAGTATAAGGAACAAGAGAGG + Intronic
918842170 1:189555862-189555884 TTTACAATAAACAGCAAGAGTGG + Intergenic
918848441 1:189650227-189650249 TAGACTAAAAGGTGCTAGAGGGG - Intergenic
921638068 1:217521144-217521166 TAGGCTATAAAGAACAAGAGTGG - Intronic
922622878 1:227004366-227004388 TGGACTAGAGGCAGGAAGAGTGG - Intronic
924365002 1:243283676-243283698 TAGACTATATGCAAGAACAGCGG - Intronic
1066950429 10:42111754-42111776 GGGACAAAAAGCAGCAAGAGCGG + Intergenic
1067844891 10:49711775-49711797 AATACTACAAACAGCAAGAGGGG - Intergenic
1070080628 10:73182912-73182934 ATGACCTTAAGCAGCAAGAGAGG - Intronic
1070086414 10:73241871-73241893 TATCCTATAAACAGCAGGAGAGG + Exonic
1070918891 10:80171770-80171792 CAGCCTCTGAGCAGCAAGAGAGG - Intronic
1071256149 10:83873651-83873673 TTGACTATCAGGAGCCAGAGAGG - Intergenic
1074295925 10:112189356-112189378 TAGACTATAAGCTTGAAGGGAGG - Intronic
1074705804 10:116129606-116129628 TTGACTATAAGCAGTAAAAGGGG - Intronic
1078896936 11:15605155-15605177 TAGACTACAAGCTCCAGGAGGGG + Intergenic
1078906944 11:15696363-15696385 TAGACTATGAGCTTCCAGAGTGG - Intergenic
1084436604 11:69145673-69145695 TAGCTTAGAAGCAGCCAGAGAGG - Intergenic
1086043679 11:82508284-82508306 TATTCTAGAAGCAGGAAGAGTGG - Intergenic
1087714309 11:101590709-101590731 TTGAATAGAAGCAGGAAGAGTGG - Intronic
1087870817 11:103290735-103290757 GAGTCTAAAAGCAACAAGAGAGG - Intronic
1090103853 11:123830428-123830450 TTGACTAGAAGTGGCAAGAGTGG - Intergenic
1091608040 12:1974052-1974074 TAGACTATAAGCTCCTGGAGGGG + Intronic
1092991148 12:13900798-13900820 TAGAGTAAAAGAAGCAAGAGGGG - Intronic
1093874923 12:24339069-24339091 TAGACTGTAAGCTCCAAAAGAGG - Intergenic
1095703005 12:45209866-45209888 TTGAATAGAAGCAGTAAGAGTGG - Intergenic
1097326535 12:58283666-58283688 TTGATTATAAGAGGCAAGAGTGG - Intergenic
1097765581 12:63523115-63523137 TAGACTATAAGTTTCATGAGGGG - Intergenic
1098105286 12:67063284-67063306 TAAACTTTAAGCACCAAGTGAGG - Intergenic
1099888662 12:88562746-88562768 TAGACTACAAGCTCCAAGAAGGG + Intronic
1106257790 13:28037641-28037663 TAGACTATCCAGAGCAAGAGGGG - Intronic
1109305250 13:60632409-60632431 TTGACTATAAGTGGTAAGAGTGG + Intergenic
1110899478 13:80802680-80802702 CAGACTAAAAGCAACAACAGCGG + Intergenic
1111561545 13:89955635-89955657 TAAATTATAATCAGAAAGAGTGG - Intergenic
1112823387 13:103362539-103362561 TAGAAGACAAGTAGCAAGAGTGG + Intergenic
1113269555 13:108657862-108657884 TAGAATAAAAGCAGCAATAAAGG + Intronic
1116012288 14:39366080-39366102 TAGACTTTAAGCAGCTTCAGTGG + Intronic
1116048591 14:39775912-39775934 TTGACTAGAAGCAGTGAGAGAGG + Intergenic
1119885771 14:78140239-78140261 AAGACTATACCCAGCCAGAGAGG - Intergenic
1120054268 14:79904198-79904220 TACACTAGAAGCAGCATCAGTGG - Intergenic
1120279455 14:82420596-82420618 TAGACTCTAAGCATCAGGAAGGG + Intergenic
1121381345 14:93471369-93471391 TTGACTTTCAGCATCAAGAGAGG - Intronic
1121478921 14:94244140-94244162 AAGACTTTAACCAGCATGAGAGG - Intronic
1124504150 15:30258172-30258194 CTGAATAGAAGCAGCAAGAGTGG + Intergenic
1124739404 15:32280473-32280495 CTGAATAGAAGCAGCAAGAGTGG - Intergenic
1125064207 15:35462244-35462266 TAGACTGTAGGGAGGAAGAGTGG - Intronic
1127193375 15:56557355-56557377 TTGAACATAAGCAGCAAGAGTGG + Intergenic
1127340237 15:58034500-58034522 TTGAATAGCAGCAGCAAGAGGGG + Intronic
1131624449 15:94102849-94102871 TAAACTATAAGAAGAAAGAAAGG + Intergenic
1131863762 15:96684012-96684034 TTGACTTTAAGGAGCAAGAGTGG - Intergenic
1132142769 15:99408713-99408735 CAGACTACCATCAGCAAGAGTGG - Intergenic
1133891469 16:9883357-9883379 TAGACTAGAATCCCCAAGAGGGG - Intronic
1135833386 16:25799017-25799039 TGGTATATAAGCAGCAAGAATGG + Intronic
1137516887 16:49152912-49152934 TTGAATAGAAGCAGTAAGAGTGG - Intergenic
1138080929 16:54090880-54090902 GAGACTACAAGGAGAAAGAGAGG - Intronic
1138638516 16:58363857-58363879 TAAACTATAATCAGCATCAGTGG + Intronic
1141012875 16:80419210-80419232 TAGAATATAAGCACCCTGAGAGG + Intergenic
1141485746 16:84339273-84339295 TAGACTATAGGCAGCAGGGGCGG - Intergenic
1142437172 16:90067972-90067994 TTGACTAGAAGTAGCAAGACTGG - Intronic
1145254022 17:21313066-21313088 TTGACCATAATCAGCAACAGAGG + Intronic
1145322574 17:21774896-21774918 TTGACCATAATCAGCAACAGAGG - Intergenic
1149393093 17:56212077-56212099 TTGAATAGAAGCAGCGAGAGTGG + Intronic
1151068211 17:71176990-71177012 CAGACTATAAACAGTAACAGTGG - Intergenic
1151122914 17:71812616-71812638 TTGAATAGAAGCAGCAAGAGTGG - Intergenic
1153191728 18:2548331-2548353 TAGCCTAGAAGCAGCAATGGGGG - Intronic
1153568183 18:6441659-6441681 TAACCTATTTGCAGCAAGAGGGG - Intergenic
1156388328 18:36626630-36626652 CAGACTATCAGCAGCAGGATGGG - Intronic
1156700371 18:39817889-39817911 TTGGCTATAAGAAGTAAGAGTGG + Intergenic
1158185164 18:54763161-54763183 TAGACAAAAAGCAGTAAGGGAGG + Intronic
1166520318 19:43475609-43475631 CAGACTATAAGTAGCAAGGCTGG - Intronic
1166780264 19:45338588-45338610 TAGACTATGAGCCCCAAGAAGGG - Intronic
1166986363 19:46661884-46661906 TAGACTCTTAGCAGCAAGACCGG - Intergenic
1167140529 19:47647695-47647717 AAGACTAAAACCAGCAACAGAGG - Intronic
1168145842 19:54419848-54419870 TAGAACATAAGCTGCACGAGGGG - Intronic
927403486 2:22741513-22741535 TAGATTATCAGCAGCAATACTGG + Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928923813 2:36555431-36555453 TAAACTATAAACATCAAGAGAGG - Intronic
929451024 2:42037281-42037303 TAGAATGTAAGCACCACGAGAGG - Intergenic
929735370 2:44542448-44542470 TAGACTCTAAGCAACTTGAGTGG - Intronic
930277753 2:49333444-49333466 TCACCTATAAGCAGCTAGAGGGG + Intergenic
932170359 2:69549725-69549747 GAGATTAAAAGCAGCATGAGTGG - Intronic
933737579 2:85507635-85507657 TAGAATACAAGCAGAAAGTGAGG + Intergenic
942657169 2:178226064-178226086 TGGGCCATAAGCAGCAAGGGAGG + Intronic
943382053 2:187162821-187162843 TAAACTATAACCTGAAAGAGTGG + Intergenic
945026345 2:205623451-205623473 TAAACTATGAGCAGCAAGGACGG - Intergenic
945634989 2:212337742-212337764 CAGGCTTTAAGTAGCAAGAGTGG - Intronic
945827679 2:214744214-214744236 TTGACTATCAGCAAGAAGAGGGG + Intronic
946458637 2:219850416-219850438 CAGACAAGAAGCAGGAAGAGAGG + Intergenic
946616766 2:221518289-221518311 TAGACTACAGGCATCAGGAGAGG - Intronic
947939422 2:234036253-234036275 TTGGCTATAACCAGCAATAGTGG - Intergenic
1169598153 20:7224875-7224897 TAGGATATAAGTAGCAAAAGTGG + Intergenic
1170729343 20:18959499-18959521 TAGGCTATAACAAGCAAGACTGG + Intergenic
1171098820 20:22361961-22361983 TAGAATAGAAGCAGCAAAAATGG - Intergenic
1171304905 20:24096818-24096840 TGGATTTTAAGGAGCAAGAGTGG - Intergenic
1174017516 20:47500873-47500895 TAGACTCTAAGAGGAAAGAGTGG + Intergenic
1174937837 20:54891749-54891771 TAGACTGTAAACAGCTTGAGAGG - Intergenic
1177352163 21:19957858-19957880 TTGACTACAAGTGGCAAGAGTGG + Intergenic
1178952419 21:36996004-36996026 TACACTATAAGAACCCAGAGAGG + Intergenic
1184321979 22:43748964-43748986 CAGATTATAAGGGGCAAGAGAGG + Intronic
953517159 3:43605474-43605496 TAAACTGAAAGCAGCATGAGTGG - Intronic
956988281 3:74730354-74730376 TATACTAACAGCACCAAGAGAGG - Intergenic
958739033 3:98045829-98045851 GAGAATAGAAGAAGCAAGAGAGG - Intergenic
959869347 3:111308860-111308882 TAGAATAAAAACAGCAAGACAGG + Intronic
960020968 3:112952995-112953017 TTGAATACAAGCGGCAAGAGTGG + Intronic
960204376 3:114877316-114877338 TAGACTATAAGCTCCTTGAGAGG - Intronic
960551319 3:118978665-118978687 TTGACTATAAACAGCATCAGTGG - Intronic
960633761 3:119761943-119761965 TTGAATAGAAGTAGCAAGAGTGG - Intronic
960658787 3:120035283-120035305 AACACTAGAAGCAGCAAGCGGGG + Intronic
961500851 3:127333903-127333925 TAGAATAGAAGTGGCAAGAGTGG - Intergenic
962842680 3:139250330-139250352 TATACTATAAGCAGGAATATTGG + Intronic
963191147 3:142474764-142474786 TTGAATATAAGTGGCAAGAGTGG + Intronic
964276379 3:155012688-155012710 TGGACAATAAGCAGGAAGAAGGG - Intergenic
964554624 3:157922708-157922730 TACACTATAGGCATCAAGAGAGG + Intergenic
965457085 3:168915136-168915158 TAAAATATAAGCAGGAAAAGTGG - Intergenic
965993581 3:174850300-174850322 TAATCTAAAAGCAGCAAAAGAGG - Intronic
970714934 4:18910832-18910854 TTTACTAGAAGTAGCAAGAGTGG - Intergenic
970957514 4:21832325-21832347 TAGAATAGAAGCAGCAAGAGTGG - Intronic
971382542 4:26111908-26111930 TAGACTTTACCCAGCAAGAGTGG + Intergenic
971492206 4:27225056-27225078 TAGATTATAAGGAGTAAGAAAGG - Intergenic
972833349 4:42839136-42839158 TAGACTGTATGGAGCGAGAGTGG - Intergenic
975235415 4:71989773-71989795 TGGACTATAGGCACTAAGAGTGG + Intergenic
976537343 4:86233183-86233205 TTGACTATAAGCAAAGAGAGTGG - Intronic
977004888 4:91553805-91553827 TAGACTAAAAGAAAAAAGAGTGG - Intronic
977451727 4:97207389-97207411 TAGAATATAGGAAGCAAGAGTGG + Intronic
978398216 4:108305136-108305158 AAGACTGTAAGCAGCAATTGAGG - Intergenic
978643377 4:110898029-110898051 AAGTCTATAAGGAGGAAGAGAGG - Intergenic
978769397 4:112438495-112438517 AAGACTATAAGGAGCAGAAGGGG + Exonic
980455968 4:133043681-133043703 TTGAGTATAAGTGGCAAGAGTGG - Intergenic
981769463 4:148290766-148290788 TAGACTAGAACCCGCTAGAGAGG - Intronic
982109003 4:152036123-152036145 TAGACTTTATGCAACAAGAAGGG + Intergenic
982869532 4:160560051-160560073 TAGTCTACAAGAAGCAAAAGAGG - Intergenic
984396569 4:179209448-179209470 GAGACGACAACCAGCAAGAGGGG + Intergenic
984412829 4:179417059-179417081 TAGAGTGTAAACTGCAAGAGAGG + Intergenic
986223212 5:5788987-5789009 CTGTCTATAAGCAGGAAGAGAGG - Intergenic
987420314 5:17712604-17712626 TAGGCTGTAAACAGCTAGAGTGG - Intergenic
990643610 5:57817295-57817317 TAGCCTGTAAGAAACAAGAGAGG + Intergenic
990762933 5:59150517-59150539 TAGATTATAAGGAGTAAGAATGG + Intronic
990954393 5:61329271-61329293 TTGACTGTGAGCAGCCAGAGGGG + Intergenic
991615093 5:68488546-68488568 TTGAGTATAAGTGGCAAGAGTGG + Intergenic
992372535 5:76159233-76159255 TTGACTAGAAATAGCAAGAGTGG - Intronic
992524378 5:77593358-77593380 TAGACTATAAGCAGCAAGAGTGG + Intronic
993647358 5:90476942-90476964 TAGACTATGAGCTTCATGAGAGG + Intronic
996015600 5:118530798-118530820 TAGAATATTAGCTGCAAGATGGG + Intergenic
996617957 5:125464090-125464112 TAGACTATAAACTCCATGAGGGG + Intergenic
998078046 5:139252412-139252434 TAGACTATAGGTGGCAAGAGTGG - Intronic
998807448 5:145932735-145932757 TAGACTGTAAACTCCAAGAGAGG - Intergenic
998988343 5:147787314-147787336 TAGACTATAAGCTCCATGAGGGG - Intergenic
999518639 5:152326823-152326845 TTGAATAGAAGTAGCAAGAGTGG + Intergenic
999683392 5:154080888-154080910 CTGACTAGAAGCAGCAAGAGTGG + Intronic
1000306973 5:160003508-160003530 AAGATTATAAGAAACAAGAGAGG + Intergenic
1004274938 6:14227709-14227731 TAGATTGTAATCACCAAGAGAGG + Intergenic
1004991025 6:21138916-21138938 GAGTCCATAAGCAGCAAGAAGGG - Intronic
1005260435 6:24053095-24053117 TACAATATGTGCAGCAAGAGAGG + Intergenic
1005736008 6:28747167-28747189 TAGACTGTGACCAGCAAAAGCGG + Intergenic
1006002119 6:30973165-30973187 TAGACTATTAGCATGGAGAGGGG + Intergenic
1006726065 6:36199923-36199945 TAGAATATAAGCTCCATGAGGGG - Intronic
1007656481 6:43454237-43454259 AAAACTAGAAGAAGCAAGAGAGG + Intronic
1007870312 6:45028319-45028341 TAGACTAAAAACAGGAAGATTGG - Intronic
1008321468 6:50119260-50119282 CAGACTAGAGACAGCAAGAGGGG - Intergenic
1008603295 6:53116602-53116624 GAGGCTATAAGGAGGAAGAGTGG + Intergenic
1010166106 6:72917173-72917195 TAGAAGATAAGCAGCAGCAGAGG - Intronic
1011219142 6:85035671-85035693 TAGATCATAAGAAGGAAGAGAGG - Intergenic
1014939817 6:127424824-127424846 TTGAATAGAAGTAGCAAGAGTGG - Intergenic
1014976613 6:127892478-127892500 TAGAATATAAGCTCCGAGAGGGG + Intronic
1017439642 6:154451865-154451887 TAGACATTACGCAGCAAGTGAGG + Intronic
1017581805 6:155873073-155873095 GAGACAAGAAGCAGCAGGAGGGG - Intergenic
1021044711 7:15908343-15908365 TATATATTAAGCAGCAAGAGTGG - Intergenic
1021230236 7:18078165-18078187 TTGACTAGAAGTGGCAAGAGTGG + Intergenic
1023696033 7:42847754-42847776 TTGACTAGAAGTGGCAAGAGTGG - Intergenic
1024216019 7:47248668-47248690 TAGAATAAAAACAGCAAGACAGG - Intergenic
1024773081 7:52748253-52748275 TAGAATATAATTAGTAAGAGTGG - Intergenic
1024880327 7:54078514-54078536 GAGATTCTAAGAAGCAAGAGGGG - Intergenic
1030702162 7:112652743-112652765 TTGAATAGAAGGAGCAAGAGTGG - Intergenic
1030847996 7:114446437-114446459 TAGATTATTAGCTCCAAGAGTGG - Intronic
1033457912 7:141519003-141519025 TAGACTGTAGAGAGCAAGAGTGG - Intergenic
1033784880 7:144718198-144718220 CAGCCTATAAGCAGCTATAGGGG + Intronic
1034922995 7:155099046-155099068 AAGTCTAGAAGCAACAAGAGTGG - Intergenic
1036938094 8:13024549-13024571 TAGGCTAGCAGCAGAAAGAGAGG - Exonic
1037734881 8:21557824-21557846 TACACTCTAAGCAGCAAAAGTGG + Intergenic
1039029282 8:33292224-33292246 TAGACTATAAAGGGCAAGTGTGG - Intergenic
1039601505 8:38842153-38842175 TAGAGTATAAGCCATAAGAGCGG + Intronic
1040582201 8:48707358-48707380 TAGACTGAAAGCACCGAGAGTGG - Intergenic
1041535631 8:58922669-58922691 TAGACTAGAAGCACCGTGAGAGG - Intronic
1041859610 8:62497969-62497991 AAGAAACTAAGCAGCAAGAGAGG - Intronic
1042801835 8:72726998-72727020 TAGATAAAAAGCAGAAAGAGAGG - Intronic
1043703298 8:83318143-83318165 TATACTATATGCAGCAAAACAGG - Intergenic
1045336889 8:101213108-101213130 TAGCCTATAAGCTTCCAGAGAGG + Intergenic
1046538897 8:115553517-115553539 TAAACGATAAGCAGCAATAATGG - Intronic
1047311753 8:123697966-123697988 GAGACTATAATGAGGAAGAGAGG - Intronic
1047509248 8:125503868-125503890 TAGACTGTAAGCTCCAGGAGAGG - Intergenic
1047628984 8:126685192-126685214 TAGAATATAAACAGCATGATGGG - Intergenic
1052207958 9:25866157-25866179 CAGACTATAAGCTCCATGAGAGG + Intergenic
1052268821 9:26605152-26605174 TAGAATACAAGCAGTAAGTGGGG + Intergenic
1052763090 9:32612601-32612623 GAGATTATAAGCAGGAAGTGGGG - Intergenic
1053081538 9:35182230-35182252 TGCACTAGAAGCAGCAATAGAGG - Intronic
1060250484 9:121983014-121983036 TAGGCTATAGGCAGTAAGGGTGG + Intronic
1062306420 9:135909408-135909430 TTGACTAGAAGCAGCAAGAGTGG + Intergenic
1203783004 EBV:111400-111422 TCAACTACAAGCAGCTAGAGCGG - Intergenic
1186699003 X:12069390-12069412 TAGACTATAGGCAGCAAGGGTGG + Intergenic
1187658692 X:21512563-21512585 AAGACTAGAAGCAGAAAGACAGG + Intronic
1187855208 X:23629979-23630001 GAGATTATGAGAAGCAAGAGAGG - Intergenic
1192744685 X:73927363-73927385 TTAAATATAAGCAACAAGAGTGG + Intergenic
1192990547 X:76450325-76450347 TTGACTAGAAGCGGCAAGAGGGG + Intergenic
1193974562 X:88101465-88101487 TACACTGTAAGCACCATGAGGGG - Intergenic
1196614733 X:117755094-117755116 TAGAATATAAGCCCCATGAGGGG - Intergenic
1198013688 X:132586969-132586991 TACACTGTAAGCAGCAGTAGTGG - Intergenic
1198040512 X:132847001-132847023 TAGTCCATCAGAAGCAAGAGGGG + Intronic