ID: 992529294

View in Genome Browser
Species Human (GRCh38)
Location 5:77639343-77639365
Sequence AGCGCCCGCTGTCTGCTTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992529282_992529294 27 Left 992529282 5:77639293-77639315 CCCACAGTGGGCCTAGAGCGCAA 0: 1
1: 0
2: 0
3: 0
4: 56
Right 992529294 5:77639343-77639365 AGCGCCCGCTGTCTGCTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
992529283_992529294 26 Left 992529283 5:77639294-77639316 CCACAGTGGGCCTAGAGCGCAAA 0: 1
1: 1
2: 0
3: 13
4: 88
Right 992529294 5:77639343-77639365 AGCGCCCGCTGTCTGCTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
992529285_992529294 16 Left 992529285 5:77639304-77639326 CCTAGAGCGCAAAGAGGAGTCGG 0: 1
1: 0
2: 0
3: 7
4: 48
Right 992529294 5:77639343-77639365 AGCGCCCGCTGTCTGCTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
992529281_992529294 28 Left 992529281 5:77639292-77639314 CCCCACAGTGGGCCTAGAGCGCA 0: 1
1: 0
2: 0
3: 7
4: 82
Right 992529294 5:77639343-77639365 AGCGCCCGCTGTCTGCTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
992529288_992529294 -10 Left 992529288 5:77639330-77639352 CCCTGGCACCGCCAGCGCCCGCT 0: 1
1: 0
2: 0
3: 16
4: 146
Right 992529294 5:77639343-77639365 AGCGCCCGCTGTCTGCTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992529294 Original CRISPR AGCGCCCGCTGTCTGCTTTG GGG Exonic
900591476 1:3462155-3462177 AGCTCCCGCTCTCTGCTGGGGGG + Intronic
905928771 1:41771545-41771567 GGCTGCCGCTGGCTGCTTTGTGG + Intronic
907426765 1:54384655-54384677 AGGGCCAGCTCTCTGCCTTGGGG - Intronic
919833942 1:201560894-201560916 TGAGCCCACTGTCTGCTTTGTGG - Intergenic
920689147 1:208132352-208132374 AGCGCCCCCTGGCTGCCCTGTGG - Intronic
923631428 1:235651048-235651070 AGCGCGCCCTGTGTCCTTTGTGG - Intergenic
1077051402 11:568530-568552 CGCGCCCACTGGCTGCGTTGCGG - Intergenic
1084419453 11:69053074-69053096 TGCGCCCGCTGGCTGCTCTGTGG + Intronic
1089556018 11:119316396-119316418 AGCGCCCGCTGGCTTATTTTGGG - Intronic
1090230328 11:125098328-125098350 GCAGCCCACTGTCTGCTTTGGGG - Intronic
1094809879 12:34126532-34126554 AGCGCAGGCTGTGTGCTCTGAGG - Intergenic
1100952290 12:99864651-99864673 ATTGCCAGCTGTCTGATTTGGGG + Intronic
1102583860 12:113909636-113909658 AGCTTCCGCTGTCTTCTCTGTGG - Intronic
1105447490 13:20470318-20470340 AGCGGCCGCTGCCTGCATTCTGG - Intronic
1113565339 13:111316372-111316394 AGCCCCCGCTGTCTGCCCTGAGG + Intronic
1113969827 13:114180402-114180424 TGCACCTGCTGTCTCCTTTGAGG + Intergenic
1119415355 14:74466036-74466058 AGCGCAGCCTGACTGCTTTGAGG + Intergenic
1123806368 15:23877847-23877869 AGCGCACGAGGTCTGCTTGGAGG + Intergenic
1127976211 15:63999046-63999068 AGCGCCTACTGTGTACTTTGTGG - Intronic
1140453781 16:75092747-75092769 AGCCCCCTCTGCCTCCTTTGTGG - Intronic
1141830736 16:86508844-86508866 AGCCCGCGCTGTCTGCTCTCAGG + Intergenic
1143874547 17:9981779-9981801 AATGTCCGCTGTCTGCTTTGGGG - Intronic
1144740563 17:17580012-17580034 AGCGGCCAGTGTCTGCTCTGGGG - Intronic
1151664034 17:75535362-75535384 AGCGCCAGCTGCCTGCTCTCAGG - Intronic
1152251963 17:79217010-79217032 GGGGCCCCCTGCCTGCTTTGGGG - Intronic
1152531032 17:80919288-80919310 AGAGGCCGCTGGCTGCTTGGTGG - Intronic
1155522299 18:26680839-26680861 AGCGACAGCTGTCTGCATTTGGG - Intergenic
1159941365 18:74411414-74411436 AGGGGCAGCTGTCTGCTGTGTGG - Intergenic
1160530435 18:79559196-79559218 AGTGCACGCTGTCTGCCATGGGG + Intergenic
1160559968 18:79750014-79750036 ACCGCCTGCTGTTTGCTTTGAGG - Intronic
1160706768 19:533550-533572 AGCCCCTTCTGTCTGCTTGGGGG + Intronic
1161608165 19:5226127-5226149 GGCGCCCTCTGGCTGCTGTGGGG - Intronic
1162195302 19:8980050-8980072 AGTCTCTGCTGTCTGCTTTGTGG + Exonic
1165853538 19:38865872-38865894 AGAGCCCGCTGTGCGCTGTGCGG + Intergenic
930780769 2:55223543-55223565 CGCGACCGCTCTCGGCTTTGGGG + Intronic
944289744 2:197991864-197991886 AGCACCCACTGTCTTCTGTGGGG + Intronic
946471128 2:219962215-219962237 AGGGCACGCTGACTGCTCTGTGG - Intergenic
1181639439 22:24188967-24188989 GGGTCTCGCTGTCTGCTTTGGGG - Exonic
1181964200 22:26645283-26645305 AGTGACCGCTGTCTGCGTCGCGG + Intergenic
1183696988 22:39429042-39429064 AGCGCTCACACTCTGCTTTGTGG - Intronic
1184373838 22:44099283-44099305 GGCGCCCGCTGGCTTCTGTGTGG + Intronic
1184859648 22:47165811-47165833 AGTGCCAGCTGTCTGCAGTGGGG - Intronic
954566723 3:51606263-51606285 AGCTCACACTGTCTGCATTGTGG + Intronic
959031621 3:101306452-101306474 AGTGCCCGCTGTATGCTGTATGG - Intronic
959105367 3:102059035-102059057 GGTACCTGCTGTCTGCTTTGGGG + Intergenic
968430718 4:556752-556774 GGCGGGGGCTGTCTGCTTTGGGG - Intergenic
992529294 5:77639343-77639365 AGCGCCCGCTGTCTGCTTTGGGG + Exonic
995853969 5:116574086-116574108 AGCGCGTGCTGTCGGCTTTGTGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1017065896 6:150528792-150528814 AGCCCCTGCAGTCTGCTCTGGGG + Intergenic
1017671657 6:156775193-156775215 AGTGCCTTCTGTCTGCTTTAGGG + Intergenic
1018446832 6:163866164-163866186 AGTGCCTGTTCTCTGCTTTGAGG - Intergenic
1018888599 6:167963885-167963907 AGCGCTCCCTGGCTGCTTGGAGG + Exonic
1019450170 7:1093532-1093554 AGCGCCCGCCGTCTGCTCCGGGG + Exonic
1019996313 7:4726664-4726686 AGCTCCCGCTGTCTGTCTTCTGG - Intronic
1027151658 7:75738248-75738270 AGCCCCAGCTGTCAGCTCTGAGG - Intronic
1027268399 7:76506224-76506246 AGCACCAGCTGTCACCTTTGTGG + Intergenic
1029558810 7:101289165-101289187 AGCTCCCACTGTCTTCTTTTCGG + Intergenic
1032756121 7:134892320-134892342 ACCGACTGTTGTCTGCTTTGGGG - Intronic
1049735574 8:144202962-144202984 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1049735589 8:144202996-144203018 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1049735603 8:144203029-144203051 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1049735617 8:144203062-144203084 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1049735635 8:144203099-144203121 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1049735648 8:144203133-144203155 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1049735664 8:144203168-144203190 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1049735678 8:144203201-144203223 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1049735692 8:144203234-144203256 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1049735707 8:144203268-144203290 AGCGCCCGCTGTCTGTGGAGGGG + Intronic
1051453646 9:17227190-17227212 AGCCCCCACTTTCAGCTTTGGGG + Intronic
1051531600 9:18110045-18110067 AGGGCCCTTTGTCTGCCTTGTGG - Intergenic
1053092529 9:35292257-35292279 AGTGCCTGCTGTGTGCTTGGAGG + Intronic