ID: 992531913

View in Genome Browser
Species Human (GRCh38)
Location 5:77660116-77660138
Sequence AGGGAAAGTGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992531913_992531919 27 Left 992531913 5:77660116-77660138 CCCACAATCACTGCACTTTCCCT No data
Right 992531919 5:77660166-77660188 TGTCATGCAGCCACTGCTGTGGG No data
992531913_992531918 26 Left 992531913 5:77660116-77660138 CCCACAATCACTGCACTTTCCCT No data
Right 992531918 5:77660165-77660187 GTGTCATGCAGCCACTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992531913 Original CRISPR AGGGAAAGTGCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr