ID: 992542833

View in Genome Browser
Species Human (GRCh38)
Location 5:77781430-77781452
Sequence CCCTAAATCTCAAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992542833_992542837 18 Left 992542833 5:77781430-77781452 CCATCCACCTTTGAGATTTAGGG 0: 1
1: 0
2: 1
3: 21
4: 133
Right 992542837 5:77781471-77781493 TTAACAGCACTGAGTGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992542833 Original CRISPR CCCTAAATCTCAAAGGTGGA TGG (reversed) Intronic
902244382 1:15110715-15110737 CCCTAAATCCCAAAGTGGGAAGG + Intronic
903107461 1:21094978-21095000 CCCTAGATCTCAATGGTAAAAGG - Intronic
903310386 1:22451109-22451131 CCCTAAATCCCAAAATTGGGAGG + Intergenic
905252482 1:36658637-36658659 CCCAAAGGCTCAAAGGAGGAAGG - Intergenic
905624481 1:39478733-39478755 CCATAAATCTAGAAGGTGGCAGG - Intronic
906526549 1:46496579-46496601 CCCAAAAGCTCAGAGTTGGAAGG + Intergenic
910822273 1:91364170-91364192 CCCTTAAACTTAAAAGTGGAAGG + Intronic
912756428 1:112328709-112328731 CCCCAAATCTCAAAAGAGCAAGG - Intergenic
914900394 1:151708420-151708442 CCTAGAATCTCAAAGCTGGAAGG + Intronic
920286057 1:204880721-204880743 CCCCAAATCCCACAGCTGGAAGG - Intronic
921541820 1:216425367-216425389 CCCTGAATTGCAAAGGTTGAGGG - Intergenic
923348291 1:233079226-233079248 CTCTAAAACTAAAAGGTGGCCGG + Intronic
1063761014 10:9076832-9076854 CCCTATATCCCAAGGGTTGATGG - Intergenic
1067231433 10:44413793-44413815 CCCTGAACCTAAAAGTTGGAAGG - Intergenic
1068860626 10:61844585-61844607 CCCTAAATCAAAACTGTGGAGGG + Intergenic
1069626684 10:69872374-69872396 CTCTAGATCTCAAAGGAGGAAGG - Intronic
1071551630 10:86570583-86570605 CCCTAAATCTCTAAGCTAAAGGG + Intergenic
1074164822 10:110865886-110865908 TTCTAAATCTCTAAGGTGGTAGG + Intergenic
1075353216 10:121744973-121744995 GCCCAAAACTCCAAGGTGGAGGG - Intronic
1076584435 10:131535599-131535621 CACTAATTCTCAGAGGTGGATGG + Intergenic
1080037855 11:27728068-27728090 CCCTGAATCTCAGAGATGAAAGG + Intergenic
1081913908 11:46718975-46718997 GGCTAAATCTCAGAGGGGGAGGG + Intergenic
1082825332 11:57573542-57573564 CCCTTAATCTCAGAACTGGAAGG + Intergenic
1085415169 11:76314782-76314804 GCCTACATCTCAAAGGTGGTGGG + Intergenic
1086050638 11:82585841-82585863 ACCAAAATCTCAAAGGTGAAGGG + Intergenic
1086538213 11:87875473-87875495 CCCTAAATCTAAAATGTGTATGG - Intergenic
1087134314 11:94700033-94700055 CCCAAAATCTCAGAGGGGCATGG + Intergenic
1089439581 11:118504035-118504057 CCAAAAATCTCACAGTTGGATGG + Exonic
1092139614 12:6173880-6173902 CCCTAAACCACAAGGGCGGAGGG + Intergenic
1093426585 12:19034953-19034975 CCCTAAACCTCAAAAGGAGAAGG - Intergenic
1098129192 12:67330822-67330844 CCCTTAATCTCAAGTCTGGATGG + Intergenic
1099623598 12:85036566-85036588 CTCGAAATCTCCAGGGTGGAAGG - Intronic
1101971578 12:109317588-109317610 CCCTACATCAAAAAGGTGGGTGG - Intergenic
1102277219 12:111591730-111591752 TCCTAAATCTTAAAAATGGAAGG - Intronic
1103167235 12:118780505-118780527 CCCTAACTCTCAAAGTTGTTTGG + Intergenic
1104735717 12:131135028-131135050 CTCTAAAGCTCAAAGGCAGAAGG + Intronic
1109327824 13:60890743-60890765 CTTTAATTCTCAAAGTTGGAGGG - Intergenic
1109491833 13:63111567-63111589 CCCTAAATATCCAATGTTGATGG + Intergenic
1109586478 13:64411195-64411217 CACTAAATCTTAAAGCTGGAGGG - Intergenic
1114719240 14:24862440-24862462 CCATTAACCCCAAAGGTGGAAGG + Intronic
1116545643 14:46162574-46162596 GCCAAAATCACAAAGCTGGAGGG - Intergenic
1116642851 14:47486618-47486640 CCATAAATCCCACATGTGGAAGG + Intronic
1117735847 14:58767598-58767620 CCTTGAATCTTAATGGTGGAAGG + Intergenic
1118322186 14:64759682-64759704 CCTTACAGCACAAAGGTGGAAGG - Intronic
1118520471 14:66577232-66577254 CACAAAATTTTAAAGGTGGAAGG + Intronic
1118747171 14:68782691-68782713 CCCTCAAACTCAAGGGTGCATGG - Intergenic
1119624796 14:76163736-76163758 CCCTACATGTAAAATGTGGATGG - Intronic
1122010158 14:98739972-98739994 CCTTAAATCTCCAAGCTGGGGGG - Intergenic
1122815155 14:104308508-104308530 CCCTATATCCCAAAGAAGGATGG + Intergenic
1125245346 15:37630407-37630429 CCCTACATGGCAAAGGTGAAGGG + Intergenic
1126340810 15:47639104-47639126 CTCTAAGGCTCAAAGGTTGAGGG + Intronic
1127761197 15:62140623-62140645 TCCTTTATCTGAAAGGTGGAGGG + Intergenic
1128049778 15:64653918-64653940 CCCTTACTCTGAAAGGTTGAAGG + Intronic
1130031216 15:80316135-80316157 CCCTAAATGTCAGAGCTGGAAGG + Intergenic
1135611793 16:23874019-23874041 CCTTGAATTTCAAAGTTGGAAGG + Intronic
1136222914 16:28839992-28840014 GCAGAAATCTCAAAGTTGGAAGG + Intergenic
1138962889 16:62048670-62048692 CCCTAAATCACACACGTGGTAGG + Intergenic
1141207577 16:81945225-81945247 CCCAAAATCTGAATGGTGGAAGG + Intronic
1144346206 17:14352368-14352390 CCCAAACTCTCAAATGGGGAAGG - Intergenic
1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG + Intronic
1147014314 17:37478463-37478485 CCCTATTTCTCAATGGTGAAAGG + Exonic
1148941239 17:51213686-51213708 TCCTAAATCACAAAGCTAGAAGG - Intronic
1153813785 18:8775775-8775797 CCCTGACTAACAAAGGTGGAAGG - Intronic
1156244758 18:35287605-35287627 CCCTAAATCTCAGAGTTGTATGG + Intronic
1159951819 18:74489669-74489691 CCTTAAATATCAAAGGATGACGG - Intergenic
1160383459 18:78478542-78478564 CCCTAAGTGTCAGAGATGGAGGG + Intergenic
1163917597 19:20255362-20255384 CCCTCAATCTCCAAAGTAGATGG - Intergenic
1166823988 19:45598114-45598136 CTCTAAATGTCACAGGAGGAAGG - Intronic
928077552 2:28278990-28279012 CCCAAATTCTCAAAAGAGGACGG - Intronic
928978607 2:37115666-37115688 CCGAGAATCTCAAAGTTGGAAGG - Intronic
932513628 2:72322175-72322197 TCATAAATGTCAAAGGTGAATGG + Intronic
937472982 2:122189584-122189606 CCCCAAATAGAAAAGGTGGATGG - Intergenic
937851749 2:126642296-126642318 CCCAAAATCTCACAGGTGGCTGG + Intergenic
940734318 2:157431966-157431988 CCCCATATCTTAAAGGTAGAAGG + Intronic
1169104040 20:2979022-2979044 CATTAACTCTAAAAGGTGGAGGG + Intronic
1178604366 21:34022926-34022948 CCCTCATTCTCAAGAGTGGATGG - Intergenic
1180705731 22:17808700-17808722 CCCCAAATCTCAGAGATGAAGGG + Intronic
949930088 3:9071625-9071647 GACTGATTCTCAAAGGTGGATGG + Intronic
954828938 3:53401618-53401640 CCCTAAATTCCAAAGCTGCAAGG - Intergenic
955649481 3:61178276-61178298 CCCTCATTTTCAGAGGTGGAAGG + Intronic
957199050 3:77108612-77108634 CCCTACATCACCAGGGTGGAAGG - Intronic
959980120 3:112506751-112506773 CCCAAAATGTCAACGGTGCAAGG + Intergenic
960467268 3:118012603-118012625 CTCTAAATGTAAAAGTTGGATGG + Intergenic
961051772 3:123752710-123752732 CCCAAGGTCTCAAAGGTAGAAGG + Intronic
962160076 3:132989736-132989758 CCCTAGATCAGAAAGGAGGAGGG - Intergenic
964422867 3:156522567-156522589 TCCTAAATCTCAAAGGCTTATGG - Intronic
966164852 3:177006153-177006175 CCCTAAATTTCAAAAATGTAAGG + Intergenic
967263880 3:187672920-187672942 TCCCAAGTCTCAAAGCTGGAAGG + Intergenic
975495512 4:75031606-75031628 CAGTAAATCACAAAGTTGGAGGG + Intronic
976990684 4:91361226-91361248 CATTAAATCTCAAAGGTTTAAGG + Intronic
977799737 4:101212607-101212629 CCCTAAATTTAAAAGTTGAAGGG + Intronic
979278394 4:118837808-118837830 TCCTAAATGTTAAAGCTGGAAGG + Intronic
981724436 4:147832807-147832829 CACTAATGTTCAAAGGTGGAAGG - Intronic
981924033 4:150117957-150117979 ACCTAACTCTCAAAGTTGTAAGG - Intronic
983935481 4:173500112-173500134 ACTTGAATCTCAAAGGGGGATGG - Intergenic
986675048 5:10176861-10176883 CCCTAAATGTGGAAGGTGGAGGG + Intergenic
990055054 5:51564511-51564533 CATTAAAACTCAAAGGTAGATGG - Intergenic
992542833 5:77781430-77781452 CCCTAAATCTCAAAGGTGGATGG - Intronic
992713797 5:79488779-79488801 ACCTAAATCTTAAAGCTAGATGG + Intronic
994578877 5:101613647-101613669 CACTAAATCTGTAAAGTGGAGGG - Intergenic
1003759366 6:9158656-9158678 TCCTAAATCTTAAAGTTAGAAGG - Intergenic
1006738185 6:36290017-36290039 CCCAGAATCTCAAAGTTGGAAGG + Intronic
1007386283 6:41522381-41522403 CCCCAAATCTCAAAGCTGGAAGG - Intergenic
1009652694 6:66496516-66496538 AACAAAATCTCTAAGGTGGATGG + Intergenic
1009835453 6:68995382-68995404 CTCTAACTCTCAAAAGTGTAGGG + Intronic
1010505855 6:76658227-76658249 ACCTAAATATCATGGGTGGATGG + Intergenic
1010963225 6:82171549-82171571 TCCTCAATCTGAAAGGAGGAAGG + Exonic
1012977627 6:105796878-105796900 CACTGAATCTCAAAGCTGTAAGG - Intergenic
1016318617 6:142818037-142818059 AACTAAATCTCAAAGGAGGAAGG + Intronic
1017591845 6:155986330-155986352 CGCTAAACCTGAAAGGTGAATGG + Intergenic
1019558784 7:1645625-1645647 CCCCAAAGCTCAAGGGTGGAGGG + Intergenic
1019563723 7:1669884-1669906 GCCCACATCTAAAAGGTGGAGGG - Intergenic
1021177566 7:17467935-17467957 CCTTAAATCTGGGAGGTGGAGGG - Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1023788931 7:43736725-43736747 CCCTTCCTCTCATAGGTGGATGG - Intergenic
1025299922 7:57810636-57810658 CCATTAATCTGAGAGGTGGAAGG + Intergenic
1026549050 7:71351497-71351519 CCCTAAATCCCCAAGATGGTTGG + Intronic
1027559985 7:79717479-79717501 GCCTTAATCTTCAAGGTGGAGGG + Intergenic
1027751331 7:82150203-82150225 CACCAAACCTTAAAGGTGGAAGG - Intronic
1029706633 7:102279897-102279919 CCCTAGATCTCAGAGGCGGGAGG - Intronic
1030270683 7:107665359-107665381 TTCTTAATCACAAAGGTGGACGG + Intronic
1030557342 7:111042976-111042998 CAATAAATGTCAAAAGTGGATGG + Intronic
1033595065 7:142853595-142853617 CCCTGAAACTCAGTGGTGGAGGG - Intergenic
1035492507 7:159292684-159292706 CTCTCAAACTGAAAGGTGGAGGG - Intergenic
1038482955 8:27914365-27914387 CCCCAAATCTCAGAGCTAGAAGG + Intronic
1038600399 8:28935559-28935581 TCCTAAACCTAAGAGGTGGAAGG + Intronic
1038912950 8:31987731-31987753 CCCTGAACCTAAAAGTTGGAAGG + Intronic
1039379989 8:37076194-37076216 CTTTGAATCTCAAGGGTGGAGGG - Intergenic
1044540375 8:93402303-93402325 CTCTGATTCTCATAGGTGGAAGG + Intergenic
1044553289 8:93535628-93535650 CTCTGACTCTCAAAGGTAGATGG + Intergenic
1045686919 8:104722000-104722022 CCCTAAAAATCAAGGCTGGAGGG - Intronic
1047483843 8:125310270-125310292 CCCCAAATCTGACAGGTGGTGGG - Intronic
1047557096 8:125944223-125944245 ACCTAGATATCAAAGGTAGAGGG - Intergenic
1048225954 8:132585493-132585515 CCCTTAATGTCACAAGTGGACGG + Intronic
1048595215 8:135859251-135859273 ACCTACATCTCAAAGGTCAAAGG - Intergenic
1053793670 9:41705367-41705389 CCATAAATCTGAGAGGTGGAAGG - Intergenic
1054151504 9:61609463-61609485 CCATAAATCTGAGAGGTGGAAGG + Intergenic
1054182081 9:61917381-61917403 CCATAAATCTGAGAGGTGGAAGG - Intergenic
1054471278 9:65540602-65540624 CCATAAATCTGAGAGGTGGAAGG + Intergenic
1058907926 9:109496863-109496885 CCCTAAATGTCAATAGTGCAAGG + Intronic
1059283760 9:113155756-113155778 CCATACATGTCAAAGCTGGAGGG - Intronic
1059424936 9:114215112-114215134 CCCTAAAGCTTAGAGCTGGAAGG + Intronic
1060792446 9:126495680-126495702 CCCTCAGTCTCACAGGTGGGTGG - Intronic
1187604240 X:20865904-20865926 CCCTGTATCTCACAGGTGTAAGG + Intergenic
1187626930 X:21125367-21125389 CACTAAACATCAAAGGAGGATGG - Intergenic
1188285944 X:28325662-28325684 CAGTAAATCTCAAAAATGGAAGG + Intergenic
1188630438 X:32351253-32351275 CCATAGATTTCAAAGGAGGAAGG - Intronic
1190277127 X:48906027-48906049 CCCAAAATCACACAGCTGGAAGG + Intronic
1194374747 X:93118260-93118282 CCCTAAACCTAAAAGTTGGAAGG + Intergenic
1194720604 X:97336095-97336117 CACTAAAACTCAAACCTGGATGG - Intronic
1196278260 X:113794398-113794420 CCCAGAATTTCAAAGGTGAAAGG + Intergenic
1196767602 X:119262382-119262404 CCCTACCTCCAAAAGGTGGAAGG - Intergenic
1197042547 X:121957129-121957151 CCCAAAATCACTAAGGTGAAGGG + Intergenic
1197624719 X:128788909-128788931 CCCTAAATTTAAAAGTTGAAGGG + Intergenic
1199913408 X:152313063-152313085 CCCTGAACCTAAAAGTTGGAAGG + Intronic
1200682770 Y:6232326-6232348 CCCTAAACCTAAAAGTTTGAAGG + Intergenic