ID: 992547836

View in Genome Browser
Species Human (GRCh38)
Location 5:77832483-77832505
Sequence CAGTGGGACTAGAGGCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992547836 Original CRISPR CAGTGGGACTAGAGGCGAGG AGG (reversed) Intronic
900868057 1:5282834-5282856 CAGGGGGACTAGGGACAAGGTGG + Intergenic
900868057 1:5282834-5282856 CAGGGGGACTAGGGACAAGGTGG + Intergenic
901014881 1:6223038-6223060 CAGTGGGACTCTAGCCAAGGCGG - Exonic
901014881 1:6223038-6223060 CAGTGGGACTCTAGCCAAGGCGG - Exonic
901813067 1:11778761-11778783 CAGTGGCTCCAGAGCCGAGGGGG - Exonic
901813067 1:11778761-11778783 CAGTGGCTCCAGAGCCGAGGGGG - Exonic
902209354 1:14893574-14893596 CAGTAGCAGTAAAGGCGAGGGGG - Intronic
902209354 1:14893574-14893596 CAGTAGCAGTAAAGGCGAGGGGG - Intronic
904010476 1:27387021-27387043 GAGAGGGAGGAGAGGCGAGGTGG - Intergenic
904010476 1:27387021-27387043 GAGAGGGAGGAGAGGCGAGGTGG - Intergenic
907516536 1:54996661-54996683 CGGGGGGACTACAGGAGAGGAGG + Intergenic
907516536 1:54996661-54996683 CGGGGGGACTACAGGAGAGGAGG + Intergenic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
924769860 1:247069853-247069875 CAGGGGGACTAGGGAAGAGGTGG + Intronic
924769860 1:247069853-247069875 CAGGGGGACTAGGGAAGAGGTGG + Intronic
1062794822 10:336762-336784 CAGTGGGACAAGAGGTGGAGGGG + Intronic
1062794822 10:336762-336784 CAGTGGGACAAGAGGTGGAGGGG + Intronic
1063870151 10:10408770-10408792 CAGTGGGACTTGTTGGGAGGTGG - Intergenic
1063870151 10:10408770-10408792 CAGTGGGACTTGTTGGGAGGTGG - Intergenic
1064118201 10:12596793-12596815 AAGGGGGACTGGAGGCCAGGAGG - Intronic
1064118201 10:12596793-12596815 AAGGGGGACTGGAGGCCAGGAGG - Intronic
1073297776 10:102451275-102451297 CCTTGGGACAAGAGGCTAGGCGG - Intronic
1073297776 10:102451275-102451297 CCTTGGGACAAGAGGCTAGGCGG - Intronic
1074814682 10:117135038-117135060 AAGTGGGAAGAGAGGCGGGGAGG + Intronic
1074814682 10:117135038-117135060 AAGTGGGAAGAGAGGCGGGGAGG + Intronic
1080092064 11:28360285-28360307 GAGTGGGATGAGAGGTGAGGTGG - Intergenic
1080092064 11:28360285-28360307 GAGTGGGATGAGAGGTGAGGTGG - Intergenic
1081465321 11:43311653-43311675 CGGTGGCACTAGAGGCTAGTGGG - Intergenic
1081465321 11:43311653-43311675 CGGTGGCACTAGAGGCTAGTGGG - Intergenic
1081568650 11:44276096-44276118 CAGTGGGGCTTGGGGTGAGGAGG + Intronic
1081568650 11:44276096-44276118 CAGTGGGGCTTGGGGTGAGGAGG + Intronic
1081866248 11:46362114-46362136 CTGTGGGAGCAGAGCCGAGGGGG + Intronic
1081866248 11:46362114-46362136 CTGTGGGAGCAGAGCCGAGGGGG + Intronic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083748125 11:64746190-64746212 CACTGGGAAGAGAGGCGTGGAGG + Intergenic
1083748125 11:64746190-64746212 CACTGGGAAGAGAGGCGTGGAGG + Intergenic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084674466 11:70626010-70626032 CAGCGGAACTGGAGGCGGGGAGG - Intronic
1084674466 11:70626010-70626032 CAGCGGAACTGGAGGCGGGGAGG - Intronic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085265937 11:75238105-75238127 AAGTGGGAAGAGAGGAGAGGAGG + Intergenic
1085265937 11:75238105-75238127 AAGTGGGAAGAGAGGAGAGGAGG + Intergenic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085771088 11:79326478-79326500 CTGTGGGTCTTTAGGCGAGGGGG - Intronic
1085771088 11:79326478-79326500 CTGTGGGTCTTTAGGCGAGGGGG - Intronic
1086160769 11:83719565-83719587 CAGTGAGAAAAGAGGCAAGGTGG + Intronic
1086160769 11:83719565-83719587 CAGTGAGAAAAGAGGCAAGGTGG + Intronic
1086560362 11:88161299-88161321 GAGTGGGAGTAGAGATGAGGAGG - Intronic
1086560362 11:88161299-88161321 GAGTGGGAGTAGAGATGAGGAGG - Intronic
1089528515 11:119112305-119112327 CTGTGGGACAAGAGGAGATGGGG - Intronic
1089528515 11:119112305-119112327 CTGTGGGACAAGAGGAGATGGGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1092046080 12:5432628-5432650 CCGAGGGACAAGAGGGGAGGAGG - Intronic
1092046080 12:5432628-5432650 CCGAGGGACAAGAGGGGAGGAGG - Intronic
1092592251 12:9962964-9962986 CAGCGGGATTAGGGGCGATGTGG + Intronic
1092592251 12:9962964-9962986 CAGCGGGATTAGGGGCGATGTGG + Intronic
1093957014 12:25232003-25232025 CTGTAGGACTAGAGGCTGGGGGG - Intronic
1093957014 12:25232003-25232025 CTGTAGGACTAGAGGCTGGGGGG - Intronic
1094492010 12:30966657-30966679 CAGAGGGACCAGAGGCCAAGGGG + Intronic
1094492010 12:30966657-30966679 CAGAGGGACCAGAGGCCAAGGGG + Intronic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1097608203 12:61782019-61782041 CAGTGGGATTTGAGACTAGGAGG + Intronic
1097608203 12:61782019-61782041 CAGTGGGATTTGAGACTAGGAGG + Intronic
1098029813 12:66242244-66242266 CGGTGGGCCAGGAGGCGAGGTGG - Intronic
1098029813 12:66242244-66242266 CGGTGGGCCAGGAGGCGAGGTGG - Intronic
1098639094 12:72818217-72818239 GAGTGGGATTAGGGGCGAAGTGG + Intergenic
1098639094 12:72818217-72818239 GAGTGGGATTAGGGGCGAAGTGG + Intergenic
1100532667 12:95474509-95474531 CTGTGGGACTAGAGGGCTGGTGG + Intronic
1100532667 12:95474509-95474531 CTGTGGGACTAGAGGGCTGGTGG + Intronic
1103320672 12:120091079-120091101 CAGTGGGCCATGAGGGGAGGCGG - Intronic
1103320672 12:120091079-120091101 CAGTGGGCCATGAGGGGAGGCGG - Intronic
1105953481 13:25255947-25255969 GAGTGGGAATGGAGGCTAGGAGG - Intronic
1105953481 13:25255947-25255969 GAGTGGGAATGGAGGCTAGGAGG - Intronic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1110929136 13:81193892-81193914 CAGTGGGACTACAGGCATTGGGG + Intergenic
1110929136 13:81193892-81193914 CAGTGGGACTACAGGCATTGGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1114554760 14:23555698-23555720 CAGTGGCAATGGTGGCGAGGGGG - Intronic
1114554760 14:23555698-23555720 CAGTGGCAATGGTGGCGAGGGGG - Intronic
1115709877 14:36039215-36039237 CAGGAGGACTAGGGGCAAGGAGG + Intergenic
1115709877 14:36039215-36039237 CAGGAGGACTAGGGGCAAGGAGG + Intergenic
1115731180 14:36271503-36271525 CACTGGGGCTTGAGGGGAGGGGG + Intergenic
1115731180 14:36271503-36271525 CACTGGGGCTTGAGGGGAGGGGG + Intergenic
1119099722 14:71868768-71868790 CAGTAGGACGAGAGGCCAAGGGG - Intergenic
1119099722 14:71868768-71868790 CAGTAGGACGAGAGGCCAAGGGG - Intergenic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1121488684 14:94342274-94342296 CAGTGGGACTAGAGGATTGTTGG + Intergenic
1121488684 14:94342274-94342296 CAGTGGGACTAGAGGATTGTTGG + Intergenic
1202905947 14_GL000194v1_random:72594-72616 GAGTGGAACTTGAGGCCAGGTGG + Intergenic
1202905947 14_GL000194v1_random:72594-72616 GAGTGGAACTTGAGGCCAGGTGG + Intergenic
1124367321 15:29081292-29081314 CTGTGGGACCAGAGGGGATGTGG + Intronic
1124367321 15:29081292-29081314 CTGTGGGACCAGAGGGGATGTGG + Intronic
1124385918 15:29208006-29208028 CAGGGGGGCTACAGGCTAGGAGG - Intronic
1124385918 15:29208006-29208028 CAGGGGGGCTACAGGCTAGGAGG - Intronic
1125070377 15:35546687-35546709 CAGAGGGCCTAGAGGTGGGGGGG - Intergenic
1125070377 15:35546687-35546709 CAGAGGGCCTAGAGGTGGGGGGG - Intergenic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128229631 15:66025437-66025459 GGGAGGGACTTGAGGCGAGGAGG + Intronic
1128229631 15:66025437-66025459 GGGAGGGACTTGAGGCGAGGAGG + Intronic
1128764247 15:70241439-70241461 CAGAGGGACAGGTGGCGAGGGGG + Intergenic
1128764247 15:70241439-70241461 CAGAGGGACAGGTGGCGAGGGGG + Intergenic
1128992018 15:72268880-72268902 CTGTGGGATTAGAAGCGAGCAGG - Intronic
1128992018 15:72268880-72268902 CTGTGGGATTAGAAGCGAGCAGG - Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130654786 15:85784949-85784971 CATTATGACTAGAGGCCAGGTGG - Intronic
1130654786 15:85784949-85784971 CATTATGACTAGAGGCCAGGTGG - Intronic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1132512648 16:352202-352224 CAGCGGGACTGGCGGCGCGGTGG - Intronic
1132512648 16:352202-352224 CAGCGGGACTGGCGGCGCGGTGG - Intronic
1132549848 16:549869-549891 CGTTGGGAGGAGAGGCGAGGCGG + Intronic
1132549848 16:549869-549891 CGTTGGGAGGAGAGGCGAGGCGG + Intronic
1134131040 16:11650496-11650518 CAGTGGGATCAGAGGCCAGCTGG + Intergenic
1134131040 16:11650496-11650518 CAGTGGGATCAGAGGCCAGCTGG + Intergenic
1135091564 16:19522019-19522041 CAGTAGAACGAGAAGCGAGGGGG + Exonic
1135091564 16:19522019-19522041 CAGTAGAACGAGAAGCGAGGGGG + Exonic
1137645018 16:50066215-50066237 GAATGGGACCGGAGGCGAGGAGG + Exonic
1137645018 16:50066215-50066237 GAATGGGACCGGAGGCGAGGAGG + Exonic
1137793749 16:51197307-51197329 CTGTGGAACTAGAAGCGATGGGG - Intergenic
1137793749 16:51197307-51197329 CTGTGGAACTAGAAGCGATGGGG - Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138116056 16:54361624-54361646 CAGTGGCACTGAAGGGGAGGAGG + Intergenic
1138116056 16:54361624-54361646 CAGTGGCACTGAAGGGGAGGAGG + Intergenic
1141699710 16:85636764-85636786 CAGTGGTGCTAGGGGTGAGGGGG - Intronic
1141699710 16:85636764-85636786 CAGTGGTGCTAGGGGTGAGGGGG - Intronic
1146582947 17:34055918-34055940 CATTGGGAATAGAGTAGAGGGGG + Intronic
1146582947 17:34055918-34055940 CATTGGGAATAGAGTAGAGGGGG + Intronic
1147650184 17:42057601-42057623 CATTGGGAGGAGAGGCAAGGGGG + Intronic
1147650184 17:42057601-42057623 CATTGGGAGGAGAGGCAAGGGGG + Intronic
1148769325 17:50057704-50057726 CAGTGGGGTCAGAGGCCAGGTGG - Intronic
1148769325 17:50057704-50057726 CAGTGGGGTCAGAGGCCAGGTGG - Intronic
1152655561 17:81517762-81517784 GAGTGGGACTGGAGGGGGGGGGG - Intronic
1152655561 17:81517762-81517784 GAGTGGGACTGGAGGGGGGGGGG - Intronic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1154166051 18:12015291-12015313 AAGTGGGTCAAGAGGGGAGGCGG - Intronic
1154166051 18:12015291-12015313 AAGTGGGTCAAGAGGGGAGGCGG - Intronic
1157259829 18:46168214-46168236 CAGAGGGACGAGCGGCCAGGGGG - Intergenic
1157259829 18:46168214-46168236 CAGAGGGACGAGCGGCCAGGGGG - Intergenic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1157922266 18:51725535-51725557 CAGTGGGAGTAGAGGCCGTGAGG + Intergenic
1157922266 18:51725535-51725557 CAGTGGGAGTAGAGGCCGTGAGG + Intergenic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1164292126 19:23878447-23878469 CAATGGGACTAGAAGAGAAGAGG + Intergenic
1164292126 19:23878447-23878469 CAATGGGACTAGAAGAGAAGAGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1167862483 19:52297005-52297027 CAGAGGCACTGGAAGCGAGGCGG + Intergenic
1167862483 19:52297005-52297027 CAGAGGCACTGGAAGCGAGGCGG + Intergenic
925448605 2:3950114-3950136 CAGCGGCACCAGAGGTGAGGGGG + Intergenic
925448605 2:3950114-3950136 CAGCGGCACCAGAGGTGAGGGGG + Intergenic
925910086 2:8568121-8568143 CAGTGAGCCCAGAGGCCAGGAGG - Intergenic
925910086 2:8568121-8568143 CAGTGAGCCCAGAGGCCAGGAGG - Intergenic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
926690380 2:15729131-15729153 AAGTGGGACTAGGGCCCAGGTGG + Intronic
926690380 2:15729131-15729153 AAGTGGGACTAGGGCCCAGGTGG + Intronic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
933899537 2:86839760-86839782 CAGTGGGACAAGAGGCCTTGTGG + Intronic
933899537 2:86839760-86839782 CAGTGGGACAAGAGGCCTTGTGG + Intronic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
934776748 2:96943772-96943794 CAGTGGGAACAAAGACGAGGTGG - Intronic
934776748 2:96943772-96943794 CAGTGGGAACAAAGACGAGGTGG - Intronic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
939290005 2:140181966-140181988 AAGTGGGACTAGAGGCATTGAGG + Intergenic
939290005 2:140181966-140181988 AAGTGGGACTAGAGGCATTGAGG + Intergenic
944037236 2:195309473-195309495 CAATGGGAGTAAAGGAGAGGGGG - Intergenic
944037236 2:195309473-195309495 CAATGGGAGTAAAGGAGAGGGGG - Intergenic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
1168888554 20:1277316-1277338 CCTTGGGACTAGAGGCCATGTGG + Intronic
1168888554 20:1277316-1277338 CCTTGGGACTAGAGGCCATGTGG + Intronic
1169143253 20:3237826-3237848 CAGGCGGGCCAGAGGCGAGGAGG + Intronic
1169143253 20:3237826-3237848 CAGGCGGGCCAGAGGCGAGGAGG + Intronic
1169794956 20:9452024-9452046 CAGTGGGAACAAAGGCTAGGTGG - Intronic
1169794956 20:9452024-9452046 CAGTGGGAACAAAGGCTAGGTGG - Intronic
1170497541 20:16940812-16940834 CAGTGGGAGAAGAGGAGACGTGG - Intergenic
1170497541 20:16940812-16940834 CAGTGGGAGAAGAGGAGACGTGG - Intergenic
1171302901 20:24079184-24079206 CAGCGGGAGAAGAGGCAAGGAGG + Intergenic
1171302901 20:24079184-24079206 CAGCGGGAGAAGAGGCAAGGAGG + Intergenic
1171327869 20:24311553-24311575 CAGTGAGATTAGAGAGGAGGTGG + Intergenic
1171327869 20:24311553-24311575 CAGTGAGATTAGAGAGGAGGTGG + Intergenic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1175243484 20:57567045-57567067 CACTGGGAGTAGAGGAGAGCAGG - Exonic
1175243484 20:57567045-57567067 CACTGGGAGTAGAGGAGAGCAGG - Exonic
1177760410 21:25396449-25396471 CAGTGTGACTAGAGGCCTGCTGG + Intergenic
1177760410 21:25396449-25396471 CAGTGTGACTAGAGGCCTGCTGG + Intergenic
1178675311 21:34626393-34626415 GAGTGGGACTCTAGGAGAGGGGG - Intergenic
1178675311 21:34626393-34626415 GAGTGGGACTCTAGGAGAGGGGG - Intergenic
1181283649 22:21736613-21736635 CAGTGACATTAGAGGCGTGGGGG - Intergenic
1181283649 22:21736613-21736635 CAGTGACATTAGAGGCGTGGGGG - Intergenic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1182414264 22:30210765-30210787 CAGTGGGACCAGAGCCCTGGTGG + Intergenic
1182414264 22:30210765-30210787 CAGTGGGACCAGAGCCCTGGTGG + Intergenic
1184485590 22:44776878-44776900 CAGTGGGCCTTGAGGCAGGGGGG - Intronic
1184485590 22:44776878-44776900 CAGTGGGCCTTGAGGCAGGGGGG - Intronic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
949515352 3:4802410-4802432 AGGAGGGACTAGAGGCAAGGAGG + Intronic
949515352 3:4802410-4802432 AGGAGGGACTAGAGGCAAGGAGG + Intronic
950654507 3:14428196-14428218 CAGTTGGAATAGAAGGGAGGGGG + Intronic
950654507 3:14428196-14428218 CAGTTGGAATAGAAGGGAGGGGG + Intronic
950759481 3:15207729-15207751 CAGTGGGACAAGATTGGAGGTGG - Intronic
950759481 3:15207729-15207751 CAGTGGGACAAGATTGGAGGTGG - Intronic
951506401 3:23449954-23449976 CAGTGGGCCCAGTGGCCAGGAGG - Intronic
951506401 3:23449954-23449976 CAGTGGGCCCAGTGGCCAGGAGG - Intronic
954636638 3:52074439-52074461 CAGTGGGACTGGTGGGGATGGGG + Intergenic
954636638 3:52074439-52074461 CAGTGGGACTGGTGGGGATGGGG + Intergenic
955042020 3:55327078-55327100 CACTGGGACTGGGGGCGGGGTGG - Intergenic
955042020 3:55327078-55327100 CACTGGGACTGGGGGCGGGGTGG - Intergenic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956129381 3:66039344-66039366 CAGTGGGACCTGCGGCAAGGGGG - Intergenic
956129381 3:66039344-66039366 CAGTGGGACCTGCGGCAAGGGGG - Intergenic
961368162 3:126414450-126414472 CAGTGGAAGTGGCGGCGAGGTGG - Intronic
961368162 3:126414450-126414472 CAGTGGAAGTGGCGGCGAGGTGG - Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
969301330 4:6299122-6299144 CAGAGGGACTGGAGGGGATGGGG - Intronic
969301330 4:6299122-6299144 CAGAGGGACTGGAGGGGATGGGG - Intronic
972686663 4:41359665-41359687 GAGTGGGACAAGAGGAGATGAGG + Intronic
972686663 4:41359665-41359687 GAGTGGGACAAGAGGAGATGAGG + Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
977401850 4:96542387-96542409 AGCTGGGACTATAGGCGAGGAGG + Intergenic
977401850 4:96542387-96542409 AGCTGGGACTATAGGCGAGGAGG + Intergenic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
998068901 5:139181274-139181296 CACTGTGACTAGAGGCATGGTGG - Intronic
998068901 5:139181274-139181296 CACTGTGACTAGAGGCATGGTGG - Intronic
999124618 5:149238085-149238107 CACTGGGGCTAAAGGCCAGGTGG - Intronic
999124618 5:149238085-149238107 CACTGGGGCTAAAGGCCAGGTGG - Intronic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1007746186 6:44044163-44044185 GAGTGGGACTGGAGGCCTGGAGG - Intergenic
1007746186 6:44044163-44044185 GAGTGGGACTGGAGGCCTGGAGG - Intergenic
1007811526 6:44489776-44489798 CAGTGGGACTAGTATCTAGGAGG - Intergenic
1007811526 6:44489776-44489798 CAGTGGGACTAGTATCTAGGAGG - Intergenic
1010433167 6:75801319-75801341 GAGAGGGACGAGAGGAGAGGAGG + Intronic
1010433167 6:75801319-75801341 GAGAGGGACGAGAGGAGAGGAGG + Intronic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1016572900 6:145534898-145534920 CACTGGACCTAGAGGTGAGGTGG - Intronic
1016572900 6:145534898-145534920 CACTGGACCTAGAGGTGAGGTGG - Intronic
1017010263 6:150058493-150058515 CAGCGGGGCTAGAGGAGAGCAGG - Intergenic
1017010263 6:150058493-150058515 CAGCGGGGCTAGAGGAGAGCAGG - Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1018362695 6:163087643-163087665 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018362695 6:163087643-163087665 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018362721 6:163087775-163087797 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018362721 6:163087775-163087797 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022791465 7:33693430-33693452 CAGTGGTACTAAAGGTTAGGAGG + Intergenic
1022791465 7:33693430-33693452 CAGTGGTACTAAAGGTTAGGAGG + Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1027613285 7:80389767-80389789 TACTAGGACTAGAGGCAAGGTGG - Intronic
1027613285 7:80389767-80389789 TACTAGGACTAGAGGCAAGGTGG - Intronic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1031143579 7:117972970-117972992 CACAGGGCCCAGAGGCGAGGGGG - Intergenic
1031143579 7:117972970-117972992 CACAGGGCCCAGAGGCGAGGGGG - Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032396166 7:131591683-131591705 CAGTGGGAGAAGAGGCTAAGTGG - Intergenic
1032396166 7:131591683-131591705 CAGTGGGAGAAGAGGCTAAGTGG - Intergenic
1036626975 8:10480238-10480260 CGGTGGGAGAAGAGGCGAGGGGG + Intergenic
1036626975 8:10480238-10480260 CGGTGGGAGAAGAGGCGAGGGGG + Intergenic
1037408019 8:18564738-18564760 CAGTGGGATTTCAGGGGAGGAGG - Intronic
1037408019 8:18564738-18564760 CAGTGGGATTTCAGGGGAGGAGG - Intronic
1037771534 8:21803334-21803356 CAGTGGGACTAGAAGATATGAGG + Intronic
1037771534 8:21803334-21803356 CAGTGGGACTAGAAGATATGAGG + Intronic
1038849159 8:31257448-31257470 CAGTGGGAAAAGATGCGAGGAGG + Intergenic
1038849159 8:31257448-31257470 CAGTGGGAAAAGATGCGAGGAGG + Intergenic
1039089335 8:33811979-33812001 AAGTGGGGGTAGAGGAGAGGAGG - Intergenic
1039089335 8:33811979-33812001 AAGTGGGGGTAGAGGAGAGGAGG - Intergenic
1040469405 8:47724811-47724833 CAGGGAGAATAGAGACGAGGAGG - Intronic
1040469405 8:47724811-47724833 CAGGGAGAATAGAGACGAGGAGG - Intronic
1040871621 8:52105575-52105597 CAGTGGGGCAAGAGGCTAAGAGG + Intergenic
1040871621 8:52105575-52105597 CAGTGGGGCAAGAGGCTAAGAGG + Intergenic
1041369680 8:57145579-57145601 CAGTGGGACAAGATTAGAGGTGG + Intergenic
1041369680 8:57145579-57145601 CAGTGGGACAAGATTAGAGGTGG + Intergenic
1044414687 8:91924012-91924034 CAGTGGGACAAGATTGGAGGTGG + Intergenic
1044414687 8:91924012-91924034 CAGTGGGACAAGATTGGAGGTGG + Intergenic
1045962042 8:107979792-107979814 CAGTGGTACTTGAGGTGGGGAGG - Intronic
1045962042 8:107979792-107979814 CAGTGGTACTTGAGGTGGGGAGG - Intronic
1046612953 8:116445941-116445963 CAGGGGGACTGGAGGAGGGGTGG - Intergenic
1046612953 8:116445941-116445963 CAGGGGGACTGGAGGAGGGGTGG - Intergenic
1053157478 9:35791348-35791370 CAGGGGGACCAGGGGCGTGGGGG + Intergenic
1053157478 9:35791348-35791370 CAGGGGGACCAGGGGCGTGGGGG + Intergenic
1053358304 9:37465359-37465381 CTAGGGGACTAGAGGCGGGGTGG - Exonic
1053358304 9:37465359-37465381 CTAGGGGACTAGAGGCGGGGTGG - Exonic
1053562394 9:39209864-39209886 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1053562394 9:39209864-39209886 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1053828200 9:42047856-42047878 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1053828200 9:42047856-42047878 CAGAGGGACTAGAAAGGAGGAGG + Intronic
1054134757 9:61409175-61409197 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1054134757 9:61409175-61409197 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1054602359 9:67139598-67139620 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1054602359 9:67139598-67139620 CAGAGGGACTAGAAAGGAGGAGG - Intergenic
1057019942 9:91689261-91689283 CACTGGGGCTAGAGGTGGGGAGG + Intronic
1057019942 9:91689261-91689283 CACTGGGGCTAGAGGTGGGGAGG + Intronic
1057164003 9:92912469-92912491 CAGTGGGATGAGGGGCAAGGAGG + Intergenic
1057164003 9:92912469-92912491 CAGTGGGATGAGGGGCAAGGAGG + Intergenic
1057523944 9:95783525-95783547 CAGTGAGACTTAAGGGGAGGGGG + Intergenic
1057523944 9:95783525-95783547 CAGTGAGACTTAAGGGGAGGGGG + Intergenic
1058434555 9:104950359-104950381 CAGTGGGACAAGATGTGAGGTGG - Intergenic
1058434555 9:104950359-104950381 CAGTGGGACAAGATGTGAGGTGG - Intergenic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1061457956 9:130712903-130712925 CAGTGGGACCAGAGCCGGGAGGG + Intergenic
1061457956 9:130712903-130712925 CAGTGGGACCAGAGCCGGGAGGG + Intergenic
1185608485 X:1380550-1380572 GAGGGGGAGGAGAGGCGAGGGGG + Intronic
1185608485 X:1380550-1380572 GAGGGGGAGGAGAGGCGAGGGGG + Intronic
1187464296 X:19514692-19514714 GAGGGGGACTAGAGACGAGGGGG + Intronic
1187464296 X:19514692-19514714 GAGGGGGACTAGAGACGAGGGGG + Intronic
1188047360 X:25441721-25441743 AAGTAGGAATAGAGGGGAGGAGG + Intergenic
1188047360 X:25441721-25441743 AAGTAGGAATAGAGGGGAGGAGG + Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1189240230 X:39519148-39519170 CAGAGGGACTCGGGGAGAGGCGG - Intergenic
1189240230 X:39519148-39519170 CAGAGGGACTCGGGGAGAGGCGG - Intergenic
1192467443 X:71367155-71367177 CAGTGGGATTGGAGGCGTCGAGG - Intronic
1192467443 X:71367155-71367177 CAGTGGGATTGGAGGCGTCGAGG - Intronic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic