ID: 992552235

View in Genome Browser
Species Human (GRCh38)
Location 5:77869689-77869711
Sequence TTATCCTGTTTTGCATTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992552235_992552237 30 Left 992552235 5:77869689-77869711 CCAGTCAATGCAAAACAGGATAA No data
Right 992552237 5:77869742-77869764 GTATCTATAGAGATATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992552235 Original CRISPR TTATCCTGTTTTGCATTGAC TGG (reversed) Intergenic
No off target data available for this crispr