ID: 992552237

View in Genome Browser
Species Human (GRCh38)
Location 5:77869742-77869764
Sequence GTATCTATAGAGATATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992552235_992552237 30 Left 992552235 5:77869689-77869711 CCAGTCAATGCAAAACAGGATAA No data
Right 992552237 5:77869742-77869764 GTATCTATAGAGATATTTTCAGG No data
992552236_992552237 -9 Left 992552236 5:77869728-77869750 CCACGTTTATCTGTGTATCTATA No data
Right 992552237 5:77869742-77869764 GTATCTATAGAGATATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992552237 Original CRISPR GTATCTATAGAGATATTTTC AGG Intergenic
No off target data available for this crispr