ID: 992552670

View in Genome Browser
Species Human (GRCh38)
Location 5:77874118-77874140
Sequence CCCACTGCACTGATGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992552670_992552677 15 Left 992552670 5:77874118-77874140 CCCATTTCCATCAGTGCAGTGGG No data
Right 992552677 5:77874156-77874178 TTGTCTCCTAACACATGGGGTGG No data
992552670_992552675 11 Left 992552670 5:77874118-77874140 CCCATTTCCATCAGTGCAGTGGG No data
Right 992552675 5:77874152-77874174 AATGTTGTCTCCTAACACATGGG No data
992552670_992552680 20 Left 992552670 5:77874118-77874140 CCCATTTCCATCAGTGCAGTGGG No data
Right 992552680 5:77874161-77874183 TCCTAACACATGGGGTGGTGGGG No data
992552670_992552683 28 Left 992552670 5:77874118-77874140 CCCATTTCCATCAGTGCAGTGGG No data
Right 992552683 5:77874169-77874191 CATGGGGTGGTGGGGACTTTGGG No data
992552670_992552679 19 Left 992552670 5:77874118-77874140 CCCATTTCCATCAGTGCAGTGGG No data
Right 992552679 5:77874160-77874182 CTCCTAACACATGGGGTGGTGGG No data
992552670_992552676 12 Left 992552670 5:77874118-77874140 CCCATTTCCATCAGTGCAGTGGG No data
Right 992552676 5:77874153-77874175 ATGTTGTCTCCTAACACATGGGG No data
992552670_992552678 18 Left 992552670 5:77874118-77874140 CCCATTTCCATCAGTGCAGTGGG No data
Right 992552678 5:77874159-77874181 TCTCCTAACACATGGGGTGGTGG No data
992552670_992552682 27 Left 992552670 5:77874118-77874140 CCCATTTCCATCAGTGCAGTGGG No data
Right 992552682 5:77874168-77874190 ACATGGGGTGGTGGGGACTTTGG No data
992552670_992552674 10 Left 992552670 5:77874118-77874140 CCCATTTCCATCAGTGCAGTGGG No data
Right 992552674 5:77874151-77874173 AAATGTTGTCTCCTAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992552670 Original CRISPR CCCACTGCACTGATGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr