ID: 992553053

View in Genome Browser
Species Human (GRCh38)
Location 5:77877344-77877366
Sequence AAAACCAAGTTGACTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992553053_992553056 2 Left 992553053 5:77877344-77877366 CCAAACAAAGTCAACTTGGTTTT No data
Right 992553056 5:77877369-77877391 TGATATTTTATACAGGCACAGGG No data
992553053_992553054 -5 Left 992553053 5:77877344-77877366 CCAAACAAAGTCAACTTGGTTTT No data
Right 992553054 5:77877362-77877384 GTTTTGTTGATATTTTATACAGG No data
992553053_992553055 1 Left 992553053 5:77877344-77877366 CCAAACAAAGTCAACTTGGTTTT No data
Right 992553055 5:77877368-77877390 TTGATATTTTATACAGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992553053 Original CRISPR AAAACCAAGTTGACTTTGTT TGG (reversed) Intergenic
No off target data available for this crispr