ID: 992554011

View in Genome Browser
Species Human (GRCh38)
Location 5:77885621-77885643
Sequence CTGTGGCTCAGGACCTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992554011_992554018 5 Left 992554011 5:77885621-77885643 CCCTCCTAGGTCCTGAGCCACAG No data
Right 992554018 5:77885649-77885671 TGTGTGATTTCAATGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992554011 Original CRISPR CTGTGGCTCAGGACCTAGGA GGG (reversed) Intergenic
No off target data available for this crispr