ID: 992558522

View in Genome Browser
Species Human (GRCh38)
Location 5:77927605-77927627
Sequence CTTTCCTGAGGGCTGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992558516_992558522 -3 Left 992558516 5:77927585-77927607 CCTTAGACTCTCTATCTTCCCTT No data
Right 992558522 5:77927605-77927627 CTTTCCTGAGGGCTGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992558522 Original CRISPR CTTTCCTGAGGGCTGGAAAA TGG Intergenic
No off target data available for this crispr