ID: 992560311

View in Genome Browser
Species Human (GRCh38)
Location 5:77945876-77945898
Sequence TGACCTCAGCCCAGGGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992560304_992560311 -3 Left 992560304 5:77945856-77945878 CCACCTCTGCAGCTCCAATGTGA 0: 1
1: 0
2: 2
3: 18
4: 227
Right 992560311 5:77945876-77945898 TGACCTCAGCCCAGGGTCTGGGG 0: 1
1: 1
2: 2
3: 35
4: 378
992560305_992560311 -6 Left 992560305 5:77945859-77945881 CCTCTGCAGCTCCAATGTGACCT 0: 1
1: 1
2: 1
3: 22
4: 186
Right 992560311 5:77945876-77945898 TGACCTCAGCCCAGGGTCTGGGG 0: 1
1: 1
2: 2
3: 35
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992560311 Original CRISPR TGACCTCAGCCCAGGGTCTG GGG Intergenic
900267200 1:1763833-1763855 TGACAGCAGCCCTGGGTCAGAGG - Intronic
900349196 1:2227076-2227098 TGACCTCCGCCCCGGGGCCGTGG - Intergenic
900509668 1:3052610-3052632 CCAGCTCAGCCCAGGGTGTGTGG + Intergenic
900898990 1:5504130-5504152 TGGGCTCAGCCCTGGGGCTGGGG + Intergenic
901033523 1:6322332-6322354 TGCCCTCATGCCAGGGTGTGTGG - Intronic
901740910 1:11341172-11341194 AGACCGCATCCCAGGCTCTGGGG + Intergenic
902606891 1:17573847-17573869 TGTCCTGAGCCCAGAGTCGGTGG - Intronic
902664308 1:17926806-17926828 TGACCTCATGCCAGGTGCTGGGG + Intergenic
903080262 1:20805247-20805269 TGTCCTTGGCCCAGGGGCTGGGG - Intergenic
903632951 1:24790694-24790716 TGACCCCATCCCAGGGGCAGGGG + Intronic
903849568 1:26297776-26297798 TGACCTGAGCCGAGAGGCTGGGG - Intronic
904823441 1:33259316-33259338 TGAACTTATCCCAGGGACTGAGG + Intronic
905878342 1:41447872-41447894 AGACCTCAGCCCAGGGGCCAAGG + Intergenic
906314103 1:44775372-44775394 TTCCCCCAGCCCAGGGTCGGAGG + Intronic
911506883 1:98763958-98763980 TGACCTCAGACCTGGGGGTGGGG - Intergenic
911507609 1:98772996-98773018 TGACCTCAGCTAAGAATCTGAGG + Intergenic
912673040 1:111649200-111649222 GGACCCCAGCTCAGGGACTGGGG - Intronic
912706508 1:111919036-111919058 TGCCCTGAGCTCAGGCTCTGGGG - Intronic
914703421 1:150152941-150152963 TGACCTCAGCCTAGGATATCTGG + Intronic
915146904 1:153800753-153800775 TGACCTCAGAGCAGGGCCAGGGG + Intergenic
915306549 1:154983122-154983144 GGACCTTAGCCCACGGTCGGGGG - Intergenic
916640103 1:166718137-166718159 TGCCCTCAGCAGAGGTTCTGTGG + Intergenic
916845315 1:168644401-168644423 TGTCCTCAGCCCAGGCTAGGTGG - Intergenic
917203415 1:172542432-172542454 GGTCCGCAGCCCAGGGGCTGGGG - Intronic
918097198 1:181345299-181345321 TCATCTCACCCCAGGGTCTGTGG - Intergenic
918828667 1:189362180-189362202 CGAACTCAGCCCATGGTCAGAGG + Intergenic
920953759 1:210598559-210598581 AGAACTCAGCCCAGTGCCTGTGG - Intronic
923500641 1:234560943-234560965 TGACCTCAGGCCTGGAGCTGGGG - Intergenic
924321701 1:242857385-242857407 TGATCTCATGCCAGGGGCTGGGG + Intergenic
1062878939 10:962940-962962 AGCCCTCTGCCCAGGGTCTCGGG - Intergenic
1063124163 10:3125021-3125043 GGACCTCAGCACAGGCCCTGGGG + Intronic
1069835757 10:71307153-71307175 TGACCCCAACCCAGGAGCTGGGG + Intergenic
1070778246 10:79122769-79122791 TGACCTCAGCCCAGGAACTTAGG - Intronic
1070778701 10:79125249-79125271 TGACCTCAGCTCAGAGCTTGGGG + Intronic
1070795449 10:79213654-79213676 TGCCCTGAACCCAGGGCCTGAGG + Intronic
1071252785 10:83838089-83838111 GGACATCTTCCCAGGGTCTGAGG + Intergenic
1071412787 10:85413268-85413290 TGACTTAAGCCCAGGGGATGAGG - Intergenic
1071595128 10:86916549-86916571 TGGCCTAAGCCCTGAGTCTGTGG + Intronic
1072549835 10:96469132-96469154 TGAGCCCAGCCCTGGCTCTGGGG + Intronic
1073261692 10:102195424-102195446 AGACATCAGCCCAGGGTATATGG + Intergenic
1073431623 10:103491064-103491086 TGAGTTCTGCCCAAGGTCTGGGG + Intergenic
1074504824 10:114060248-114060270 GGGCCTCAGCCCAGAGTCTGGGG + Intergenic
1074996037 10:118758426-118758448 AGACCTGAGGCCAGGGGCTGTGG - Intergenic
1075398829 10:122147098-122147120 TGACCTCAGCCAAGCAACTGAGG - Intronic
1075532768 10:123243993-123244015 TGGTCTCAGTCCAGGGCCTGGGG + Intergenic
1075966352 10:126615093-126615115 TAACCTCAGCCCAGCCTCCGTGG - Intronic
1076779611 10:132717003-132717025 GGACCTCAGCCTTGGGGCTGGGG - Intronic
1076795114 10:132794607-132794629 TGCCCTCTGCCCAGGAGCTGTGG + Intergenic
1076871168 10:133195840-133195862 TGGCCCCAGCCCAGGGTCCAAGG + Intronic
1076904377 10:133354920-133354942 TGTCCACAGCCCAGGGGCTATGG + Intergenic
1077263783 11:1638581-1638603 GGAGCCCAGCCCAGGGTCGGGGG - Intergenic
1077341197 11:2027145-2027167 CTCCCTCTGCCCAGGGTCTGTGG - Intergenic
1077424140 11:2466555-2466577 TGACATCTGCCCAGGCTCGGGGG + Intronic
1077991055 11:7412879-7412901 TGCACTCTTCCCAGGGTCTGAGG - Intronic
1078342741 11:10511153-10511175 TGTCCACAGCCCAGGGGTTGTGG - Intergenic
1078358679 11:10651956-10651978 TGGCCTCAGCCCAGGGTGCTTGG + Intronic
1078668085 11:13342309-13342331 TGAAAGCAGCCCAGGCTCTGAGG - Intronic
1082991224 11:59208665-59208687 TGACCTTAGCCTGGGGTCTGTGG - Exonic
1083000339 11:59285263-59285285 TAACCTTAGGCTAGGGTCTGTGG - Intergenic
1083201574 11:61123965-61123987 TGGCCTCTGTCCAGGGCCTGAGG - Intronic
1083335566 11:61919759-61919781 TGCCTTCAGCCAAGGGTCTGTGG - Intronic
1083641190 11:64146287-64146309 TGACCTCAGTCCTGTGTCTGGGG - Intronic
1083725190 11:64624215-64624237 TGTCCTCAGCCCGGGTTTTGGGG - Intronic
1084861092 11:72018704-72018726 AGAGCTCAGCCCTGGGCCTGTGG - Intronic
1085252813 11:75154743-75154765 TGCCCTGACCCCAGGGTCTCTGG + Intronic
1087060542 11:93972923-93972945 GGTCCACAGCCCAGGGACTGGGG - Intergenic
1087123810 11:94602927-94602949 TGATGTCAGCCCAGGATCTGCGG - Intronic
1089130294 11:116207098-116207120 TCACCCCAGCCCAGAGGCTGAGG - Intergenic
1089213675 11:116822768-116822790 TGACCTCAGCCCTGGCTCCTGGG + Exonic
1089242692 11:117096546-117096568 TGACTTCCCCTCAGGGTCTGAGG + Intronic
1089604784 11:119635586-119635608 TGTCCTGAGCCCAGGGGCCGTGG - Intronic
1089678668 11:120107423-120107445 TGACCTCAACCCAGCGGATGAGG - Intergenic
1089704905 11:120270979-120271001 TGACTTCAGGCCAGGCACTGTGG - Intronic
1089747403 11:120627009-120627031 TGGCCTCTGCCCAGGGCCTTGGG - Intronic
1091205320 11:133817036-133817058 TGACCTATGCACAGAGTCTGGGG - Intergenic
1202824182 11_KI270721v1_random:82334-82356 CTCCCTCTGCCCAGGGTCTGTGG - Intergenic
1091582726 12:1798907-1798929 TGCCCTGAGCCCAGGGGCAGAGG + Intronic
1091699969 12:2652774-2652796 CCAGCTCAGCCCAGGCTCTGGGG + Intronic
1091714252 12:2765797-2765819 TGAGCACAGCCTAGGGTGTGGGG - Intergenic
1091758430 12:3071527-3071549 TGGGCTCAGACCAGGGTCTGTGG + Intergenic
1091933732 12:4417857-4417879 TGACCTGAGCCCAGTTTCTGGGG - Intergenic
1093090369 12:14913483-14913505 TGACTCCCGCCCAGGGGCTGTGG + Intergenic
1094130025 12:27064598-27064620 TGACCTCTGCCCTGGGGCTCAGG + Intronic
1094179484 12:27576594-27576616 TGACCTCTGCCCTGGGGCTCAGG + Intronic
1095521037 12:43066494-43066516 TGCCCTCTGCTCAGTGTCTGAGG - Intergenic
1096225835 12:49866482-49866504 TGAGCCCAGCCAAGGTTCTGTGG + Intergenic
1096669118 12:53187831-53187853 TGACCTCAGCCAAGGGTCCAGGG - Exonic
1096889203 12:54749637-54749659 TAACCAGTGCCCAGGGTCTGAGG - Intergenic
1097288640 12:57896422-57896444 TACCCTCAGGCCAGGGTGTGCGG - Intergenic
1097703430 12:62843904-62843926 TGAGCTTTGCCCTGGGTCTGGGG - Intronic
1098162474 12:67658478-67658500 TGACCCCAGGCCAGGCTTTGCGG + Exonic
1098283277 12:68883156-68883178 TGACCTGACTTCAGGGTCTGTGG - Intronic
1099778002 12:87158881-87158903 TGACCTTAGCCTAGGGTCTAAGG + Intergenic
1101696386 12:107131277-107131299 TGGCCTCTGCCCAGGATCTCTGG - Intergenic
1101727326 12:107398894-107398916 AGAACTCAACCCTGGGTCTGTGG - Intronic
1102693650 12:114781288-114781310 TGATCTCTCCCCAGGGTCTTGGG - Intergenic
1102720634 12:115013290-115013312 CGGCCCCAGCCCAGGGTCTCTGG + Intergenic
1103622978 12:122200210-122200232 TGACCTCAGCCCAGGGCTTGTGG - Exonic
1104065758 12:125304308-125304330 GGTCCACAGCCCAGGGTTTGGGG + Intronic
1104811126 12:131621041-131621063 TGGCCTCAGCCCTGGGGCTCTGG - Intergenic
1105445935 13:20457085-20457107 CCACCTCAGCCCAGCCTCTGTGG + Intronic
1107135203 13:36937159-36937181 TGACTTCAGCCCAGGAGTTGAGG - Intergenic
1107490191 13:40874151-40874173 TTCCCTCAACCCAGTGTCTGAGG - Intergenic
1109255581 13:60076470-60076492 TGACAGAAGCCCAGGGGCTGAGG - Intronic
1113147601 13:107225562-107225584 TCACCTGAGGCCAGGTTCTGTGG - Intronic
1113368542 13:109701185-109701207 TGACCTAAGGCCAAGATCTGCGG - Intergenic
1113642033 13:111964581-111964603 GGACCATAGCCCAGGGCCTGCGG + Intergenic
1114261252 14:21038128-21038150 AGACTTCAGCCCTGGGTTTGAGG - Intronic
1114465688 14:22920687-22920709 AGACCTCAGGCCAGGGGGTGAGG - Exonic
1116853341 14:49930155-49930177 TTACCTCAGGCCAGGCTCAGTGG - Intergenic
1119391259 14:74292685-74292707 TGTCCTTGGCCCAGTGTCTGTGG - Intronic
1119681679 14:76597015-76597037 TGACATCTGCTCAGGTTCTGGGG + Intergenic
1121120539 14:91373136-91373158 GGTCCTGAGCCCAGGGGCTGGGG - Intronic
1122893665 14:104744685-104744707 GGTCCACAGCCCAGGGACTGGGG + Intronic
1122905512 14:104799950-104799972 AGACCCCAGCCCAGCGTCTATGG - Intergenic
1123036151 14:105472790-105472812 TGGCCGCTGCCCAGGGACTGCGG + Intergenic
1124367273 15:29081057-29081079 TGAGCTCAGCTCCAGGTCTGGGG - Intronic
1124473211 15:30007358-30007380 TGAGCTCAGGCCTGGGGCTGGGG + Intergenic
1125230253 15:37446567-37446589 TCACCTGAGCCTAGGGACTGAGG + Intergenic
1125499751 15:40232243-40232265 AGTCCACAGCCCAGGGGCTGGGG + Intergenic
1126212058 15:46111201-46111223 TCACTTCAGGCCATGGTCTGAGG - Intergenic
1127008603 15:54597454-54597476 TTTACTTAGCCCAGGGTCTGTGG + Intronic
1127021731 15:54756065-54756087 GGACCTCAGCCCAGGGAGAGAGG + Intergenic
1127323684 15:57872835-57872857 TGAACTGAGGCCAGGGTCTGTGG - Intergenic
1127531469 15:59847365-59847387 TGCCCTCAGTCCAGGGTTTTTGG - Intergenic
1129275309 15:74441639-74441661 TGAGCCCAGCCCAGGGCCAGAGG + Intergenic
1130884888 15:88084520-88084542 TGAGCTCAGACCAGGGACTTCGG - Intronic
1131144868 15:90004054-90004076 AGTCCTCAGCCCACGGTGTGTGG + Intronic
1132500146 16:281420-281442 TGAGGGCAGCCCAGGGTCAGGGG - Intronic
1132739091 16:1402114-1402136 CGAACTCAGCACATGGTCTGGGG - Intronic
1133020903 16:2966601-2966623 TGACCCCAGGGCAGGGGCTGGGG - Intronic
1135246262 16:20859912-20859934 TGCACTCAGCTCAGGGCCTGAGG - Exonic
1136272922 16:29159068-29159090 TGACCTCACCCGAGGGTGGGAGG + Intergenic
1136294622 16:29294627-29294649 TGACCTCAGCCCAGCGGCCCAGG - Intergenic
1136325598 16:29521666-29521688 TGACCTCTGCCCAGCAACTGAGG - Intergenic
1136440287 16:30261648-30261670 TGACCTCTGCCCAGCAACTGAGG - Intergenic
1137605877 16:49786511-49786533 TGCCCTCAGCCCAGGGACATTGG + Intronic
1138122855 16:54414419-54414441 TGACCTCAGGCCAGGCGCGGTGG - Intergenic
1138551599 16:57751738-57751760 TGACCTGGGCCCAGGGGCTGGGG + Intronic
1138924731 16:61576910-61576932 TTCCTTCAGCCCAGGGTCCGTGG + Intergenic
1140084863 16:71786336-71786358 TGCCCTTAGTCCAGGGACTGTGG + Intronic
1142076479 16:88120880-88120902 TGACCTCACCCGAGGGTGGGAGG + Intergenic
1142100528 16:88268671-88268693 TGACCTCAGCCCAGCGGCCCAGG - Intergenic
1142156728 16:88535709-88535731 TGTCCTCAGCCCTGGCTCTGAGG - Exonic
1143098040 17:4488966-4488988 TGACCCCAGCACAGCGTATGGGG + Intergenic
1143129018 17:4664404-4664426 ACACCTCAGCACAGGGACTGTGG - Intergenic
1143838783 17:9714246-9714268 TGTCCACAGCCCAGGGGTTGGGG + Intronic
1143957199 17:10680193-10680215 TGAATTCAGCTCTGGGTCTGGGG + Exonic
1144650109 17:17002054-17002076 TGACTTCAGTCCAGGGTAGGCGG - Intergenic
1146573088 17:33969502-33969524 TGACATCAGCAGAGGATCTGGGG + Intronic
1146977975 17:37131974-37131996 TAATCTCAGCCCAGGCACTGCGG + Intronic
1147332602 17:39707665-39707687 TGGCCCCATTCCAGGGTCTGTGG - Intronic
1147556751 17:41484525-41484547 TGGCCTCAGGCCAGGGTCAGGGG + Intergenic
1148577165 17:48720136-48720158 TGCCCTCAGCCTGGGGTCTGCGG + Intergenic
1148734948 17:49860125-49860147 TGACCTCTGCCCTTGGCCTGCGG - Intergenic
1148776176 17:50096803-50096825 TGGCCTTGGCCCAGGGTCAGGGG - Intronic
1149536689 17:57438757-57438779 TGACCGGAGCCTAGGGCCTGAGG + Intronic
1151511975 17:74566310-74566332 TGCTCTCAGCTCAGGCTCTGGGG + Intergenic
1151891938 17:76956252-76956274 TTGCTTCAGCCCAGGGGCTGGGG - Intergenic
1152334416 17:79692288-79692310 TCCCCTCAGCCCAGGGACAGCGG - Intergenic
1152560095 17:81073615-81073637 TGCTCTCAGCCCAGGGTTGGAGG - Intronic
1152637949 17:81437869-81437891 TGACCTCCAGCCAGGGTCGGGGG + Intronic
1152788433 17:82264504-82264526 AGCCCTCAGCCCAGGGCCTTAGG - Intronic
1153186797 18:2495079-2495101 TGACTTCATCCCCTGGTCTGGGG + Intergenic
1153684269 18:7529375-7529397 TGACCTCCAGCCTGGGTCTGAGG + Intergenic
1153915358 18:9740027-9740049 TCTCGTCACCCCAGGGTCTGAGG - Intronic
1154071840 18:11159762-11159784 GGACCTCAGTCCAGAGTCTGCGG - Intergenic
1154312746 18:13280239-13280261 AGAACTCAACCCAAGGTCTGTGG - Intronic
1156894184 18:42225991-42226013 TGACATCAGCCCATAGACTGTGG + Intergenic
1157509651 18:48261742-48261764 TGGCATCAGCTCAGGCTCTGTGG + Intronic
1157808543 18:50676921-50676943 GGTCCTCAGCCCAGGGGTTGGGG - Intronic
1158039049 18:53070319-53070341 TTACCTCACCCCAGGGCCAGAGG + Intronic
1158516206 18:58132117-58132139 ATCCCTCAGCCCTGGGTCTGTGG - Intronic
1158592023 18:58785738-58785760 TGCTCTCAGCCCAGGACCTGGGG - Intergenic
1158810071 18:61021733-61021755 TGTCCACAGCCCAGGGGTTGGGG - Intergenic
1160158566 18:76452491-76452513 TGACTCCAGCCCGTGGTCTGAGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161226507 19:3148908-3148930 TGGCCTTGCCCCAGGGTCTGGGG - Intronic
1161585786 19:5104795-5104817 TGAGACCTGCCCAGGGTCTGGGG - Intronic
1161728210 19:5942941-5942963 TCACCTGAGCCCGGGGTCTGAGG + Intronic
1163645094 19:18484861-18484883 TGCCTTCTGCCCATGGTCTGCGG + Intronic
1163670099 19:18622632-18622654 TGAGCTCTGCCCAGGGGATGAGG - Intergenic
1163861046 19:19743027-19743049 TGACCAAAGTCCAGTGTCTGTGG + Intergenic
1164145537 19:22510422-22510444 TGCCCTCAGCCCTGCTTCTGAGG - Intronic
1164821109 19:31251802-31251824 TGCTCTCAGCCCTGGCTCTGTGG - Intergenic
1165189570 19:34051370-34051392 TGACATCAGGCCAGGGGCAGAGG + Intergenic
1165223894 19:34340613-34340635 TGACTTGAGCCCAGGAGCTGGGG - Intronic
1165392057 19:35544537-35544559 GGCCCTCAGCACAGTGTCTGAGG - Intronic
1166759918 19:45218008-45218030 TGGCCCCTGCCCGGGGTCTGCGG - Intronic
1166803813 19:45473300-45473322 TGACGTCAACCCAAGCTCTGGGG + Exonic
1167324654 19:48816601-48816623 TGACCTCGGATCAGGGTTTGAGG - Intronic
1168355165 19:55695817-55695839 TGACCTGAGCCCTGGGTCCCTGG - Intronic
1168415064 19:56162487-56162509 TGGTGTCAGGCCAGGGTCTGAGG + Intergenic
927222772 2:20729510-20729532 TGTCCTCAGCCCTGGGACTCTGG + Intronic
927569335 2:24144679-24144701 TGACCTCAGCACAGGGGCCACGG + Intronic
927947293 2:27143593-27143615 TGAGATAAGCCCTGGGTCTGCGG + Intergenic
930716715 2:54600178-54600200 TGACCGCAGGCAAGGGTCTAAGG + Intronic
930799332 2:55426188-55426210 GGTCCACAGCCCAGGGACTGGGG + Intergenic
934947738 2:98554221-98554243 TGAGCCCAGGCCAGGGGCTGGGG - Intronic
935059540 2:99595682-99595704 TGGCCTCACCCCAGGCACTGAGG + Intronic
935598187 2:104896271-104896293 TGCCCTCAGCCCTGTGTCTTGGG + Intergenic
936080656 2:109430416-109430438 TTGCCTCAGCCCAGGCTGTGTGG + Intronic
936094015 2:109517997-109518019 TGGGCTGAGCCCAGGGGCTGAGG + Intergenic
936874715 2:117174479-117174501 TGATCTCAGGCAAGAGTCTGAGG - Intergenic
937102110 2:119279746-119279768 TGACCTCAGGCCAGGTGCAGTGG - Intergenic
937108181 2:119338763-119338785 TGATATAAGCCCTGGGTCTGGGG - Intronic
937250266 2:120519401-120519423 TGACCCCAGTGCAGGGTCAGTGG - Intergenic
937314020 2:120919725-120919747 TGGCCACAGCCAAGGGGCTGAGG + Intronic
937829856 2:126407625-126407647 TGAGCTCAGCTGTGGGTCTGTGG - Intergenic
938310500 2:130285808-130285830 TGCCCTGGGCACAGGGTCTGTGG - Intergenic
938369433 2:130760168-130760190 GGAGCCCAGCCCAGGTTCTGTGG + Intronic
938444427 2:131366559-131366581 TGCCCTGGGCACAGGGTCTGTGG + Intergenic
944225572 2:197345828-197345850 TCACCTGAGCCCAGGGGTTGAGG + Intergenic
944453001 2:199862512-199862534 TGAGTTCAGCCCAGCGTATGTGG + Intergenic
944880633 2:204009421-204009443 TGAACTCATGCCAGGGTCTCAGG + Intergenic
946247577 2:218396366-218396388 AGACCCCAGCCCAGGACCTGCGG + Exonic
946782562 2:223206082-223206104 ATACCTCATCCCAGGGTCTGGGG + Intergenic
947813031 2:233016088-233016110 TTCCCTCAGCCCTGGGCCTGGGG - Intergenic
947949632 2:234136060-234136082 TGACCGCAGCCGAGGATGTGGGG + Intergenic
948679060 2:239619943-239619965 TTAGCTCATCCCAGGGTATGTGG + Intergenic
948757656 2:240168763-240168785 TGCCCTCAGCCCAGGGGTTGGGG + Intergenic
1169581595 20:7029240-7029262 GGACCGCAGCCCAGGGGTTGAGG + Intergenic
1169675675 20:8151517-8151539 TGACATTAGCGTAGGGTCTGTGG - Intronic
1171240925 20:23566447-23566469 TAACCTCAGCCCTGGGACAGAGG + Intronic
1171242697 20:23584927-23584949 TAACCTCAGCCCTGGGACAGAGG - Intergenic
1172099139 20:32475084-32475106 TGCTCTCAGCCCAGGGACCGGGG + Intronic
1172768311 20:37362803-37362825 TGACCTCACTCCAGGGTGTGGGG + Intronic
1172873648 20:38151076-38151098 GGACCTCAGCTCTGGGTCTGCGG + Intronic
1173027110 20:39318647-39318669 TATCCACAGGCCAGGGTCTGTGG - Intergenic
1173860573 20:46280573-46280595 AGACCTCAGCCTATGGTCTGGGG + Intronic
1173981074 20:47224591-47224613 TGACCCCAGCCTGGGGTGTGGGG + Intronic
1175522220 20:59609242-59609264 TGCCCTGAGCCCAGGGCCTGGGG - Intronic
1175539728 20:59740981-59741003 TGACCCCTTCCCTGGGTCTGAGG + Intronic
1176112902 20:63418586-63418608 TGACCTCAGCCCCTGCCCTGAGG + Intronic
1177140404 21:17352409-17352431 TGACCTCTTCCCAGTGTCTCTGG - Intergenic
1177182623 21:17759206-17759228 GGACCTAAGCCCTGGGTCTTTGG + Intergenic
1179406967 21:41134449-41134471 AGACCTAAGCTCAGGATCTGAGG - Intergenic
1179442901 21:41407936-41407958 TGGTCTCAGCCCAAGGCCTGTGG - Intronic
1179717511 21:43297485-43297507 TGACCACAGGGCAGGGTTTGGGG - Intergenic
1180057081 21:45364616-45364638 TGAGCTCAGCCCGGGACCTGGGG + Intergenic
1180844064 22:18972022-18972044 TGCCCCCAGCCCAGGGTGTGAGG + Intergenic
1180955395 22:19739116-19739138 TCACCCCAGCACAGGGTGTGGGG + Intergenic
1180976818 22:19853282-19853304 TCACTTGTGCCCAGGGTCTGGGG + Intronic
1181036816 22:20173741-20173763 TCCCCGCAGCCCAGTGTCTGTGG + Intergenic
1182021510 22:27085586-27085608 TGACTTCATCCCAGGGACAGTGG - Intergenic
1182034288 22:27185712-27185734 GGACATTGGCCCAGGGTCTGAGG - Intergenic
1182048924 22:27298608-27298630 TGACCTCTGCCCACAATCTGTGG + Intergenic
1182100249 22:27652709-27652731 TGACCTCACCCCTGGGTCCCTGG - Intergenic
1182441299 22:30365861-30365883 AGACTTCTCCCCAGGGTCTGGGG + Intronic
1182832297 22:33313817-33313839 GGCCCTCTGCCCAGGGTCTCAGG - Intronic
1183237695 22:36631878-36631900 GGACCTCAGGCTAGAGTCTGAGG + Intronic
1184955615 22:47884066-47884088 TAAACTCACCCCAGGGTCAGGGG + Intergenic
950436681 3:12984386-12984408 TTAGCTCAGCCCTGGGCCTGTGG - Intronic
951186288 3:19717200-19717222 GGCCCTCAGTCTAGGGTCTGTGG - Intergenic
951210616 3:19970365-19970387 TCACCTGATTCCAGGGTCTGTGG + Intronic
952520148 3:34148685-34148707 TGTCCTCACCCCAGGTTCTTGGG - Intergenic
954662587 3:52234070-52234092 TGACCCCTGCCCAGTCTCTGAGG + Intronic
956886914 3:73569606-73569628 AAACCTCAGCCCTGTGTCTGGGG + Intronic
957183289 3:76909141-76909163 TGCCTTGAGCCCAGGGTTTGAGG + Intronic
957808631 3:85187023-85187045 TGACCCCAGTCCAGTGCCTGAGG - Intronic
959237323 3:103741227-103741249 TCACTTGAGCCCAGGGACTGAGG + Intergenic
960155531 3:114294081-114294103 TGATCTGGGCCCAGGGGCTGAGG + Exonic
960225106 3:115159019-115159041 AGTCCTCAGCCCAGGGGTTGGGG - Intergenic
961252661 3:125520086-125520108 AGCCCCCAGCCCAGCGTCTGGGG + Exonic
961383140 3:126508733-126508755 TGATCTGTGACCAGGGTCTGGGG + Intronic
964525871 3:157614842-157614864 TGTCCTCAGACCAGGAGCTGAGG + Intronic
964525872 3:157614845-157614867 TGACCTCAGCTCCTGGTCTGAGG - Intronic
964763942 3:160160222-160160244 TGACCCCAGCACAGGGTCAAAGG + Intergenic
966050789 3:175616625-175616647 TGACCTCTGCCTGGGGCCTGGGG + Intronic
968333744 3:197894971-197894993 TTACTTCAGCCCAGGATTTGAGG + Intronic
968451556 4:678440-678462 TGGCTTCAGCACAGGGACTGGGG - Intronic
968733938 4:2285618-2285640 TGTGCTCAACCCAGGGGCTGTGG - Intronic
969079577 4:4608070-4608092 TGGGGTCAGCCCAGGGACTGCGG + Intergenic
969255765 4:6000687-6000709 TGAGCTCAGTACAGGGGCTGGGG - Intergenic
969656085 4:8499317-8499339 ACACCTCAGCTCAGGGGCTGGGG - Intergenic
969891990 4:10268486-10268508 TGTCCACAGCCCAGGGTCAGAGG - Intergenic
970341013 4:15106843-15106865 TGACCTTTGCCCAGGGTTTCTGG - Intergenic
972685223 4:41346023-41346045 TTACCTCAGCTCTGGGTATGTGG - Intergenic
972697271 4:41459768-41459790 TTACCTCAGCCCAGAGACAGGGG + Intronic
975401530 4:73944391-73944413 TGCCTGCAGCCCAGGCTCTGTGG + Intergenic
975621792 4:76304201-76304223 AGGCCTCAGACCAAGGTCTGGGG - Intronic
976592175 4:86859988-86860010 TGACCTGAGCCCAGGAATTGAGG - Intergenic
978489593 4:109298444-109298466 TGACCTCAGCTCAGTTCCTGTGG - Intronic
979483758 4:121247585-121247607 TGACGTCAGGCCAGGTGCTGTGG + Intergenic
981081228 4:140641575-140641597 TGACCACAGCCTGGGGTCTCTGG + Intronic
981099849 4:140817938-140817960 TTACCTGAGCCCAGGGATTGAGG - Intergenic
981716088 4:147753639-147753661 TGACTTCAGGCCAGGGGCAGTGG - Intronic
983513748 4:168635677-168635699 AGCCATCAACCCAGGGTCTGAGG + Intronic
983588529 4:169382479-169382501 TGACCTCATGGCAGAGTCTGGGG + Intergenic
983811277 4:172065410-172065432 GGTCCTCAGCCCAGGGGTTGGGG + Intronic
985125464 4:186689684-186689706 TGTCCTTAGCCCAGGGTATCTGG + Intronic
985491868 5:184805-184827 TGACTTGAGCCCAGGAACTGGGG + Exonic
985812705 5:2101831-2101853 GGGCCTCAGCACAGGGTCTTTGG + Intergenic
986518317 5:8586659-8586681 TGACCTAAGACTAGTGTCTGTGG - Intergenic
986812892 5:11378668-11378690 TGACCCCATCCCAGGAGCTGTGG + Intronic
988479561 5:31618680-31618702 TGTTCTGTGCCCAGGGTCTGTGG + Intergenic
989434093 5:41391172-41391194 TGAATTCAGCCCAGGGACAGTGG + Intronic
991490249 5:67175830-67175852 TGACTCCAGTGCAGGGTCTGAGG - Intergenic
991625542 5:68596958-68596980 GGTCCACAGCCCAGGGACTGGGG + Intergenic
992560311 5:77945876-77945898 TGACCTCAGCCCAGGGTCTGGGG + Intergenic
994690941 5:103018852-103018874 TTCCCTCTGCCCATGGTCTGTGG - Intronic
996655354 5:125927786-125927808 AGACATCAGCCCAGGGTATATGG - Intergenic
996805425 5:127448964-127448986 TGACCTGAGCTCAGGGGCCGAGG - Intronic
996926452 5:128832800-128832822 AGTCTCCAGCCCAGGGTCTGAGG - Intronic
998929543 5:147165709-147165731 TGTCATCAGTCCATGGTCTGGGG + Intergenic
999152390 5:149434838-149434860 TTACTTAAGCCCAGGGTGTGGGG - Intergenic
999191121 5:149748122-149748144 TGAGCACAGCCCAGGGTCTGAGG + Intronic
999534769 5:152504349-152504371 TGAGCACAGCCTTGGGTCTGTGG - Intergenic
999748370 5:154608886-154608908 TGATCTCAGCCCTGGCTGTGGGG + Intergenic
1000905162 5:166957421-166957443 TGACCTCCTCCCAGGCTGTGTGG - Intergenic
1002197592 5:177509682-177509704 TGTCTTCAGCTCAGGGGCTGGGG + Intronic
1002263025 5:178007520-178007542 TGGGCTCAGCCCAGGGTGGGAGG + Intronic
1002992180 6:2247970-2247992 CAACGTCAGCACAGGGTCTGGGG + Intergenic
1003533066 6:6953931-6953953 GGAACTCAGCCCAGGGACAGTGG - Intergenic
1004508760 6:16267630-16267652 TCACCGCAGCCGAAGGTCTGTGG + Intronic
1006402309 6:33824994-33825016 AGAGCTCAGCCCAGGGACTGGGG - Intergenic
1006453706 6:34120272-34120294 AGGCCTCAGCACAGGGCCTGGGG + Intronic
1006932189 6:37695193-37695215 TCACCACAGCCCCGGGGCTGGGG - Intronic
1007711602 6:43827849-43827871 TGTCCCCAGCCCAGTGTCTCTGG + Intergenic
1008615664 6:53223199-53223221 TGATATAAGCCCTGGGTCTGAGG + Intergenic
1009205881 6:60800883-60800905 TCACCTCACCCCAGGCACTGTGG + Intergenic
1016886363 6:148963358-148963380 TGCCCTCTGCCCAGAGACTGGGG + Intronic
1017871369 6:158489227-158489249 GACCCTCAGCCCAGGTTCTGTGG + Intronic
1018433794 6:163743871-163743893 TCACCTCAGTGCAGGGTTTGGGG - Intergenic
1018825058 6:167402483-167402505 TGAGCCCAGCCTGGGGTCTGGGG + Intergenic
1018988112 6:168653244-168653266 TGACCACTGCCCAGGGTCGGGGG - Intronic
1019070407 6:169340741-169340763 TGAGCTCACTGCAGGGTCTGCGG + Intergenic
1019189797 6:170245160-170245182 TGACCTCAGCTCCCTGTCTGTGG + Intergenic
1019280081 7:195192-195214 TGACCTCAGCTGAGGGTGCGAGG - Intronic
1019303708 7:322402-322424 GGACCCCAGACCTGGGTCTGCGG - Intergenic
1019614251 7:1951843-1951865 TGAGCGCACCCCAGCGTCTGTGG - Intronic
1020001533 7:4759068-4759090 GGACATCAGCCCGGGGTGTGTGG - Exonic
1022274981 7:28846365-28846387 TGACGTCAGCTCAGGCTTTGGGG - Intergenic
1022673709 7:32478931-32478953 GGACATCAGCCCAGGGCCTGAGG - Intergenic
1022835352 7:34108401-34108423 TGACCTCAGCCAGTGGGCTGTGG - Intronic
1023112108 7:36824309-36824331 AGTCCGCAGCCCAGGGACTGGGG + Intergenic
1023815447 7:43946103-43946125 TGACCCCAACGCAGGGGCTGGGG - Intronic
1023822137 7:43986299-43986321 TGCCCTCAGCCCAGGCACTTCGG - Intergenic
1023872883 7:44272237-44272259 TAACCCCGGCCCAAGGTCTGGGG + Intronic
1024281587 7:47723535-47723557 AGCCCGCAGCCCAGGGGCTGGGG - Intronic
1026313774 7:69210839-69210861 AGTCCTCAGCCCAGGATTTGGGG - Intergenic
1027174066 7:75892266-75892288 TGGCCTTATCCCAGGGGCTGGGG + Intergenic
1028798883 7:94938060-94938082 AGACCACGGCCCAGGGTCTGAGG - Intronic
1029750404 7:102539713-102539735 TGCCCTCAGCCCAGGCACTTCGG - Intronic
1029768356 7:102638821-102638843 TGCCCTCAGCCCAGGCACTTCGG - Exonic
1030205069 7:106944486-106944508 CTACCACAGCCCAGGATCTGGGG - Intergenic
1032182550 7:129692736-129692758 TGGCCGCAGCCCAGTGACTGAGG - Intronic
1032486124 7:132288754-132288776 TGCCCTCAGCACTGTGTCTGTGG - Intronic
1032784403 7:135188886-135188908 TTGCCCCAGCCCAGGCTCTGGGG + Intronic
1034385121 7:150734585-150734607 GGACCTCAGCCCAGTGGCTCAGG + Intronic
1034765949 7:153721466-153721488 TTACCCCATCTCAGGGTCTGGGG - Intergenic
1035029896 7:155850019-155850041 TCACAGCAGCCCAGGCTCTGGGG + Intergenic
1036005097 8:4653040-4653062 TGTCCTCAGTCCAGGGCTTGGGG + Intronic
1036218963 8:6904406-6904428 TGTACTCAGCCCAGGAGCTGGGG + Intergenic
1037423035 8:18724526-18724548 TCACTTGAGCCCAGAGTCTGAGG + Intronic
1037770904 8:21799060-21799082 TAACCTTAGCACAGGGTCTGAGG + Intronic
1037814291 8:22103675-22103697 TGACCTCTGCCCAGGTGCTGTGG - Exonic
1037970133 8:23165790-23165812 TGACCCTAGCTCAGTGTCTGGGG - Intergenic
1038676171 8:29624613-29624635 TGACTTCAGCCCAGGATCCATGG + Intergenic
1040436607 8:47397682-47397704 TGAGGGGAGCCCAGGGTCTGTGG + Intronic
1040521191 8:48177297-48177319 TCACACCAGCCCAGGGTCAGAGG - Intergenic
1040946842 8:52893424-52893446 CCACTTCAGCCCAGGGTCAGCGG + Intergenic
1041246513 8:55893889-55893911 TCACTTCAGCCCAGGATCTCAGG - Intronic
1041728024 8:61036357-61036379 AGACCTCTGGCCAGGCTCTGTGG + Intergenic
1043760672 8:84063627-84063649 TGAACTGAGCCCAGAGTCAGTGG - Intergenic
1045057438 8:98381788-98381810 TGCCCTCTACCCAGGCTCTGGGG + Intergenic
1045315538 8:101040731-101040753 AGCCATCAGCCCAGGGTCTCTGG - Intergenic
1045980870 8:108185636-108185658 GGTCCTCAGCCCAGGGATTGGGG + Intergenic
1045981910 8:108199631-108199653 AGTCCACAGCCCAGGGGCTGCGG + Intergenic
1049238941 8:141526862-141526884 TGAGCTCAGCTCTGGGCCTGGGG - Intergenic
1049310949 8:141933603-141933625 AGAGCTCACCCCAGGCTCTGGGG - Intergenic
1049353747 8:142177657-142177679 TGACCCCAGCCTCCGGTCTGCGG - Intergenic
1049499772 8:142955653-142955675 TGACCTCTGACCAGGGTCCGTGG + Intergenic
1049579434 8:143404657-143404679 TGACCTCAGCCCGGGGGGTGGGG - Intergenic
1051157814 9:14170420-14170442 TCACTTCAGCCCAGGAGCTGGGG + Intronic
1051689564 9:19695962-19695984 GGTCCACAGCCCAGGGACTGGGG - Intronic
1052243240 9:26300977-26300999 TGCCCTGATCCCAGGCTCTGAGG + Intergenic
1052720076 9:32163695-32163717 TCACATCAGCCCAAGGTCTTAGG + Intergenic
1053040402 9:34865716-34865738 AGGTATCAGCCCAGGGTCTGTGG + Intergenic
1053470692 9:38344444-38344466 AGGTGTCAGCCCAGGGTCTGTGG + Intergenic
1055971498 9:81916797-81916819 TGACCTCTGGGCAGGGTTTGAGG - Intergenic
1055973238 9:81931842-81931864 TGACCTCGGGGCAGGGTTTGAGG - Intergenic
1055974991 9:81946934-81946956 TGACCTCGGGGCAGGGTTTGAGG - Intergenic
1057704805 9:97388881-97388903 TGGCCTCAGCCCAGCCTTTGGGG - Intergenic
1058671788 9:107366505-107366527 TGACCTCAGCCGTGGCCCTGGGG + Intergenic
1059051725 9:110933964-110933986 TGACCCAAGCCCAGGATGTGGGG + Intronic
1059641191 9:116218562-116218584 TGACCTAAGACCTGGTTCTGAGG - Intronic
1060348583 9:122837901-122837923 GGACCTCAGGCCAGAGACTGGGG + Intergenic
1061412673 9:130429796-130429818 GCACCTCAGCTCAGGGGCTGAGG + Intronic
1061664352 9:132151745-132151767 TGCCCGCAGCCCAGAGTTTGGGG - Intergenic
1062021609 9:134322151-134322173 TGACCTCAGCCCTGGGTCTGGGG + Intronic
1062150998 9:135018991-135019013 GGGCCTCAGCCCAGGATCTCTGG - Intergenic
1062272922 9:135718024-135718046 GGACCCCAGCCCTGGCTCTGTGG + Intronic
1062324257 9:136004800-136004822 GGATCTGAGCCCAGAGTCTGGGG - Intergenic
1062545992 9:137063981-137064003 GGCCATCACCCCAGGGTCTGTGG + Exonic
1062612809 9:137382675-137382697 TGACCTCAGGCCAGTGGATGTGG + Intronic
1062658274 9:137615166-137615188 TGGCCTCTGCCCTGGGACTGGGG + Exonic
1186022261 X:5269290-5269312 TGCCCTCGGCCCAGGGATTGAGG + Intergenic
1187237890 X:17485429-17485451 TGACCTCAGCCTCAGCTCTGGGG - Intronic
1187386199 X:18851092-18851114 TGTCCGCAGTCCAGGGACTGGGG - Intergenic
1188753295 X:33929969-33929991 GGTCCGCAGCCCAGGGACTGGGG - Intergenic
1189182582 X:39017990-39018012 TGACCTCCCACCAGGGACTGTGG + Intergenic
1189774610 X:44459369-44459391 TGAGGTCAGCCCAGGTTCAGGGG + Intergenic
1191851161 X:65587516-65587538 TCAGCTCAGCCCTGGCTCTGAGG + Intergenic
1193532574 X:82674356-82674378 TGACCTCTTCCCAGGGTGTAGGG + Intergenic
1196871901 X:120120552-120120574 AGATCGCAGCCCAGAGTCTGCGG + Intergenic
1198346805 X:135767626-135767648 TGACCTGAGCCCGGGGGGTGGGG - Intronic
1198348712 X:135784910-135784932 TGACCTGAGCCCGGGGGGTGGGG - Intergenic
1198350617 X:135802184-135802206 TGACCTGAGCCCGGGGGGTGGGG - Intronic
1198352524 X:135819447-135819469 TGACCTGAGCCCGGGGGGTGGGG - Intronic
1198354433 X:135836715-135836737 TGACCTGAGCCCGGGGGGTGGGG - Intronic
1198356343 X:135853973-135853995 TGACCTGAGCCCGGGGGGTGGGG - Intronic
1198358256 X:135871247-135871269 TGACCTGAGCCCGGGGGGTGGGG - Intergenic
1198360170 X:135888521-135888543 TGACCTGAGCCCGGGGGGTGGGG - Intronic
1200799171 Y:7370176-7370198 TCAGCTCAGACCAGAGTCTGGGG + Intergenic
1200887534 Y:8284330-8284352 TTACCACAGCCCAGGGACTTTGG - Intergenic
1201262804 Y:12176920-12176942 AAACCTCAGCCCAGGCTCAGTGG + Intergenic