ID: 992560465

View in Genome Browser
Species Human (GRCh38)
Location 5:77947480-77947502
Sequence AAATATAAGCAAAAATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992560462_992560465 -5 Left 992560462 5:77947462-77947484 CCACTTGGATTTGAAAACAAATA No data
Right 992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG No data
992560459_992560465 18 Left 992560459 5:77947439-77947461 CCTTTGCTACTGAAAAGCAAAGG No data
Right 992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992560465 Original CRISPR AAATATAAGCAAAAATTGGG TGG Intergenic
No off target data available for this crispr