ID: 992562793

View in Genome Browser
Species Human (GRCh38)
Location 5:77968949-77968971
Sequence CAGGCATGAGCCACCATGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343332
Summary {0: 451, 1: 10455, 2: 44604, 3: 107737, 4: 180085}

Found 23 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562793_992562800 5 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562800 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG 0: 5
1: 126
2: 1860
3: 4287
4: 5350
992562793_992562798 4 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562798 5:77968976-77968998 TCCAGCACTTTGGGAGACCAGGG 0: 131
1: 7277
2: 98711
3: 219513
4: 235503
992562793_992562815 24 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562815 5:77968996-77969018 GGGGTTGGGGCGGGGGGGGGGGG No data
992562793_992562797 3 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562797 5:77968975-77968997 TTCCAGCACTTTGGGAGACCAGG No data
992562793_992562819 28 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562819 5:77969000-77969022 TTGGGGCGGGGGGGGGGGGGGGG 0: 6
1: 49
2: 459
3: 9861
4: 21199
992562793_992562810 20 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562810 5:77968992-77969014 ACCAGGGGTTGGGGCGGGGGGGG No data
992562793_992562806 16 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562806 5:77968988-77969010 GGAGACCAGGGGTTGGGGCGGGG No data
992562793_992562813 22 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562813 5:77968994-77969016 CAGGGGTTGGGGCGGGGGGGGGG No data
992562793_992562804 14 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562804 5:77968986-77969008 TGGGAGACCAGGGGTTGGGGCGG No data
992562793_992562808 18 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562808 5:77968990-77969012 AGACCAGGGGTTGGGGCGGGGGG No data
992562793_992562814 23 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562814 5:77968995-77969017 AGGGGTTGGGGCGGGGGGGGGGG 0: 2
1: 1
2: 69
3: 804
4: 7821
992562793_992562802 10 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562802 5:77968982-77969004 ACTTTGGGAGACCAGGGGTTGGG No data
992562793_992562801 9 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562801 5:77968981-77969003 CACTTTGGGAGACCAGGGGTTGG No data
992562793_992562817 26 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562817 5:77968998-77969020 GGTTGGGGCGGGGGGGGGGGGGG No data
992562793_992562807 17 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562807 5:77968989-77969011 GAGACCAGGGGTTGGGGCGGGGG No data
992562793_992562809 19 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562809 5:77968991-77969013 GACCAGGGGTTGGGGCGGGGGGG No data
992562793_992562805 15 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562805 5:77968987-77969009 GGGAGACCAGGGGTTGGGGCGGG No data
992562793_992562812 21 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562812 5:77968993-77969015 CCAGGGGTTGGGGCGGGGGGGGG No data
992562793_992562803 11 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562803 5:77968983-77969005 CTTTGGGAGACCAGGGGTTGGGG No data
992562793_992562816 25 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562816 5:77968997-77969019 GGGTTGGGGCGGGGGGGGGGGGG No data
992562793_992562795 -5 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562795 5:77968967-77968989 GCCTGTAATTCCAGCACTTTGGG 0: 8353
1: 231656
2: 273926
3: 181702
4: 144141
992562793_992562794 -6 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562794 5:77968966-77968988 TGCCTGTAATTCCAGCACTTTGG 0: 4304
1: 100967
2: 237366
3: 242802
4: 214495
992562793_992562818 27 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562818 5:77968999-77969021 GTTGGGGCGGGGGGGGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562793 Original CRISPR CAGGCATGAGCCACCATGCT CGG (reversed) Intergenic
Too many off-targets to display for this crispr