ID: 992562794

View in Genome Browser
Species Human (GRCh38)
Location 5:77968966-77968988
Sequence TGCCTGTAATTCCAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 799934
Summary {0: 4304, 1: 100967, 2: 237366, 3: 242802, 4: 214495}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562793_992562794 -6 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562794 5:77968966-77968988 TGCCTGTAATTCCAGCACTTTGG 0: 4304
1: 100967
2: 237366
3: 242802
4: 214495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562794 Original CRISPR TGCCTGTAATTCCAGCACTT TGG Intergenic
Too many off-targets to display for this crispr