ID: 992562795

View in Genome Browser
Species Human (GRCh38)
Location 5:77968967-77968989
Sequence GCCTGTAATTCCAGCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 839778
Summary {0: 8353, 1: 231656, 2: 273926, 3: 181702, 4: 144141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562793_992562795 -5 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562795 5:77968967-77968989 GCCTGTAATTCCAGCACTTTGGG 0: 8353
1: 231656
2: 273926
3: 181702
4: 144141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562795 Original CRISPR GCCTGTAATTCCAGCACTTT GGG Intergenic
Too many off-targets to display for this crispr