ID: 992562796

View in Genome Browser
Species Human (GRCh38)
Location 5:77968968-77968990
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 21 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562796_992562808 -1 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562808 5:77968990-77969012 AGACCAGGGGTTGGGGCGGGGGG No data
992562796_992562812 2 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562812 5:77968993-77969015 CCAGGGGTTGGGGCGGGGGGGGG No data
992562796_992562816 6 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562816 5:77968997-77969019 GGGTTGGGGCGGGGGGGGGGGGG No data
992562796_992562802 -9 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562802 5:77968982-77969004 ACTTTGGGAGACCAGGGGTTGGG No data
992562796_992562820 12 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562820 5:77969003-77969025 GGGCGGGGGGGGGGGGGGGGTGG No data
992562796_992562821 21 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562821 5:77969012-77969034 GGGGGGGGGGGTGGATCATGAGG No data
992562796_992562806 -3 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562806 5:77968988-77969010 GGAGACCAGGGGTTGGGGCGGGG No data
992562796_992562807 -2 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562807 5:77968989-77969011 GAGACCAGGGGTTGGGGCGGGGG No data
992562796_992562805 -4 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562805 5:77968987-77969009 GGGAGACCAGGGGTTGGGGCGGG No data
992562796_992562801 -10 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562801 5:77968981-77969003 CACTTTGGGAGACCAGGGGTTGG No data
992562796_992562818 8 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562818 5:77968999-77969021 GTTGGGGCGGGGGGGGGGGGGGG No data
992562796_992562810 1 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562810 5:77968992-77969014 ACCAGGGGTTGGGGCGGGGGGGG No data
992562796_992562814 4 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562814 5:77968995-77969017 AGGGGTTGGGGCGGGGGGGGGGG No data
992562796_992562819 9 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562819 5:77969000-77969022 TTGGGGCGGGGGGGGGGGGGGGG No data
992562796_992562804 -5 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562804 5:77968986-77969008 TGGGAGACCAGGGGTTGGGGCGG No data
992562796_992562817 7 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562817 5:77968998-77969020 GGTTGGGGCGGGGGGGGGGGGGG No data
992562796_992562815 5 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562815 5:77968996-77969018 GGGGTTGGGGCGGGGGGGGGGGG No data
992562796_992562809 0 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562809 5:77968991-77969013 GACCAGGGGTTGGGGCGGGGGGG No data
992562796_992562803 -8 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562803 5:77968983-77969005 CTTTGGGAGACCAGGGGTTGGGG No data
992562796_992562822 26 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562822 5:77969017-77969039 GGGGGGTGGATCATGAGGTCAGG No data
992562796_992562813 3 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562813 5:77968994-77969016 CAGGGGTTGGGGCGGGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562796 Original CRISPR TCCCAAAGTGCTGGAATTAC AGG (reversed) Intergenic