ID: 992562799

View in Genome Browser
Species Human (GRCh38)
Location 5:77968977-77968999
Sequence CCCCTGGTCTCCCAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562799_992562821 12 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562821 5:77969012-77969034 GGGGGGGGGGGTGGATCATGAGG No data
992562799_992562813 -6 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562813 5:77968994-77969016 CAGGGGTTGGGGCGGGGGGGGGG No data
992562799_992562819 0 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562819 5:77969000-77969022 TTGGGGCGGGGGGGGGGGGGGGG No data
992562799_992562809 -9 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562809 5:77968991-77969013 GACCAGGGGTTGGGGCGGGGGGG No data
992562799_992562810 -8 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562810 5:77968992-77969014 ACCAGGGGTTGGGGCGGGGGGGG No data
992562799_992562816 -3 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562816 5:77968997-77969019 GGGTTGGGGCGGGGGGGGGGGGG No data
992562799_992562812 -7 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562812 5:77968993-77969015 CCAGGGGTTGGGGCGGGGGGGGG No data
992562799_992562814 -5 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562814 5:77968995-77969017 AGGGGTTGGGGCGGGGGGGGGGG No data
992562799_992562808 -10 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562808 5:77968990-77969012 AGACCAGGGGTTGGGGCGGGGGG No data
992562799_992562820 3 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562820 5:77969003-77969025 GGGCGGGGGGGGGGGGGGGGTGG No data
992562799_992562817 -2 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562817 5:77968998-77969020 GGTTGGGGCGGGGGGGGGGGGGG No data
992562799_992562815 -4 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562815 5:77968996-77969018 GGGGTTGGGGCGGGGGGGGGGGG No data
992562799_992562818 -1 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562818 5:77968999-77969021 GTTGGGGCGGGGGGGGGGGGGGG No data
992562799_992562822 17 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562822 5:77969017-77969039 GGGGGGTGGATCATGAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562799 Original CRISPR CCCCTGGTCTCCCAAAGTGC TGG (reversed) Intergenic