ID: 992562800

View in Genome Browser
Species Human (GRCh38)
Location 5:77968977-77968999
Sequence CCAGCACTTTGGGAGACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562793_992562800 5 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG No data
Right 992562800 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562800 Original CRISPR CCAGCACTTTGGGAGACCAG GGG Intergenic