ID: 992562804

View in Genome Browser
Species Human (GRCh38)
Location 5:77968986-77969008
Sequence TGGGAGACCAGGGGTTGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562796_992562804 -5 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562804 5:77968986-77969008 TGGGAGACCAGGGGTTGGGGCGG No data
992562793_992562804 14 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG No data
Right 992562804 5:77968986-77969008 TGGGAGACCAGGGGTTGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562804 Original CRISPR TGGGAGACCAGGGGTTGGGG CGG Intergenic