ID: 992562813

View in Genome Browser
Species Human (GRCh38)
Location 5:77968994-77969016
Sequence CAGGGGTTGGGGCGGGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562799_992562813 -6 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562813 5:77968994-77969016 CAGGGGTTGGGGCGGGGGGGGGG No data
992562796_992562813 3 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 992562813 5:77968994-77969016 CAGGGGTTGGGGCGGGGGGGGGG No data
992562793_992562813 22 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562813 5:77968994-77969016 CAGGGGTTGGGGCGGGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562813 Original CRISPR CAGGGGTTGGGGCGGGGGGG GGG Intergenic
No off target data available for this crispr