ID: 992562814

View in Genome Browser
Species Human (GRCh38)
Location 5:77968995-77969017
Sequence AGGGGTTGGGGCGGGGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8697
Summary {0: 2, 1: 1, 2: 69, 3: 804, 4: 7821}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562796_992562814 4 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 992562814 5:77968995-77969017 AGGGGTTGGGGCGGGGGGGGGGG 0: 2
1: 1
2: 69
3: 804
4: 7821
992562799_992562814 -5 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562814 5:77968995-77969017 AGGGGTTGGGGCGGGGGGGGGGG 0: 2
1: 1
2: 69
3: 804
4: 7821
992562793_992562814 23 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562814 5:77968995-77969017 AGGGGTTGGGGCGGGGGGGGGGG 0: 2
1: 1
2: 69
3: 804
4: 7821

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562814 Original CRISPR AGGGGTTGGGGCGGGGGGGG GGG Intergenic
Too many off-targets to display for this crispr