ID: 992562815

View in Genome Browser
Species Human (GRCh38)
Location 5:77968996-77969018
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562796_992562815 5 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA No data
Right 992562815 5:77968996-77969018 GGGGTTGGGGCGGGGGGGGGGGG No data
992562793_992562815 24 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG No data
Right 992562815 5:77968996-77969018 GGGGTTGGGGCGGGGGGGGGGGG No data
992562799_992562815 -4 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562815 5:77968996-77969018 GGGGTTGGGGCGGGGGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type