ID: 992562819

View in Genome Browser
Species Human (GRCh38)
Location 5:77969000-77969022
Sequence TTGGGGCGGGGGGGGGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31574
Summary {0: 6, 1: 49, 2: 459, 3: 9861, 4: 21199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992562796_992562819 9 Left 992562796 5:77968968-77968990 CCTGTAATTCCAGCACTTTGGGA 0: 11218
1: 302003
2: 259881
3: 147035
4: 132604
Right 992562819 5:77969000-77969022 TTGGGGCGGGGGGGGGGGGGGGG 0: 6
1: 49
2: 459
3: 9861
4: 21199
992562799_992562819 0 Left 992562799 5:77968977-77968999 CCAGCACTTTGGGAGACCAGGGG No data
Right 992562819 5:77969000-77969022 TTGGGGCGGGGGGGGGGGGGGGG 0: 6
1: 49
2: 459
3: 9861
4: 21199
992562793_992562819 28 Left 992562793 5:77968949-77968971 CCGAGCATGGTGGCTCATGCCTG 0: 451
1: 10455
2: 44604
3: 107737
4: 180085
Right 992562819 5:77969000-77969022 TTGGGGCGGGGGGGGGGGGGGGG 0: 6
1: 49
2: 459
3: 9861
4: 21199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992562819 Original CRISPR TTGGGGCGGGGGGGGGGGGG GGG Intergenic
Too many off-targets to display for this crispr