ID: 992563631

View in Genome Browser
Species Human (GRCh38)
Location 5:77976304-77976326
Sequence TTTGCCCTGCGGAGCTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992563627_992563631 29 Left 992563627 5:77976252-77976274 CCATAACCTTGGGTTGACAGATT No data
Right 992563631 5:77976304-77976326 TTTGCCCTGCGGAGCTCCTGAGG No data
992563628_992563631 23 Left 992563628 5:77976258-77976280 CCTTGGGTTGACAGATTTTCAGT No data
Right 992563631 5:77976304-77976326 TTTGCCCTGCGGAGCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992563631 Original CRISPR TTTGCCCTGCGGAGCTCCTG AGG Intergenic
No off target data available for this crispr