ID: 992564692

View in Genome Browser
Species Human (GRCh38)
Location 5:77985849-77985871
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992564687_992564692 30 Left 992564687 5:77985796-77985818 CCATCATGGGGGCCTTTAGTGCT No data
Right 992564692 5:77985849-77985871 ACTACCTTCTGGGCTGTTCCCGG No data
992564688_992564692 18 Left 992564688 5:77985808-77985830 CCTTTAGTGCTTGTGACTTCAAA No data
Right 992564692 5:77985849-77985871 ACTACCTTCTGGGCTGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type