ID: 992570460

View in Genome Browser
Species Human (GRCh38)
Location 5:78050109-78050131
Sequence CCTTCCAGGTAGAGGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992570460_992570465 1 Left 992570460 5:78050109-78050131 CCTGGGACCCTCTACCTGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 212
Right 992570465 5:78050133-78050155 ACTTTCTCCAGAGACCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992570460 Original CRISPR CCTTCCAGGTAGAGGGTCCC AGG (reversed) Intronic
900507675 1:3037771-3037793 AGACCCAGGTAGAGGGTCCCTGG - Intergenic
901082841 1:6593212-6593234 CCTTCCAGGTAATGGATCCTGGG + Exonic
901206613 1:7501172-7501194 CCTTCCAGGGAGAGCCTCCCTGG - Intronic
901400688 1:9013483-9013505 CCTTCCTGCTGGAGGGTCTCTGG - Intronic
901671399 1:10858273-10858295 CCTGGCAGCTAAAGGGTCCCTGG - Intergenic
902622078 1:17656463-17656485 CCTCCTAGGGAGAGGGCCCCAGG - Intronic
902869854 1:19307409-19307431 CCCTGCAGGGAGAGGGACCCCGG + Exonic
907163298 1:52387388-52387410 TCTTCCACGAAGGGGGTCCCTGG + Intronic
909523072 1:76591732-76591754 CCTCCCAGGTAGAGGCAGCCAGG - Intronic
911078805 1:93908737-93908759 CGTGCCAGGAAGAGGGACCCAGG + Intronic
912386277 1:109272689-109272711 CCTTCCAGGAACAGGCTGCCTGG - Exonic
912451565 1:109770615-109770637 CCATCCAGGTAGGCAGTCCCAGG + Intronic
915041884 1:152974734-152974756 CCTGCCAGGTGGAGGGCCTCTGG + Intergenic
915323109 1:155066870-155066892 CCTGCCAGGCAGAGGGCCCCCGG + Exonic
915507405 1:156366550-156366572 CCTGCCAGGCAGGGGGCCCCAGG + Intronic
915932379 1:160068565-160068587 CATGCCAGGGAGAGGGTCCAGGG - Intronic
916802894 1:168231103-168231125 CCTGCCTGGTGGAGGATCCCAGG + Intronic
918299074 1:183185995-183186017 CATTCCAGGCAAAGGCTCCCGGG + Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
919922937 1:202177144-202177166 CCTGCCCGGTACAGGGTCACCGG - Intergenic
920176894 1:204107683-204107705 CCTTTGGGGGAGAGGGTCCCTGG - Intronic
920551988 1:206869741-206869763 CCCTTCAGGTTGAGTGTCCCTGG + Intergenic
1065414955 10:25474186-25474208 CCTTCCTTGTAGAGGGTCAAGGG - Intronic
1069825720 10:71253889-71253911 GCTGCAAGGTGGAGGGTCCCAGG + Intronic
1070555396 10:77523461-77523483 TCTCCCAGGTAGAGGTTACCAGG - Intronic
1070734106 10:78851827-78851849 ACATCCAGGGAGAGGGTGCCGGG + Intergenic
1071177378 10:82942146-82942168 CCCTCCAGGTATAGGGACCTAGG - Intronic
1072042483 10:91621883-91621905 CCTTCCAGGAGGAGGAACCCTGG + Intergenic
1075229439 10:120661427-120661449 CTTTCCACATAGAGGTTCCCTGG - Intergenic
1075267812 10:121019564-121019586 CCTTCCAGTCCGAGGTTCCCTGG - Intergenic
1075495386 10:122915115-122915137 ACTTCCAGGACGAGGGTCTCAGG - Intergenic
1076440333 10:130477033-130477055 CTTCCCAGGTAGAGGGGCCACGG + Intergenic
1076991431 11:278148-278170 ACTTCCAGGTAGAGGGAACAGGG - Intergenic
1077112194 11:866767-866789 CCTTCCAGAAACAGGGTTCCGGG - Exonic
1077375750 11:2204438-2204460 CCGTCCAGGCAGATAGTCCCAGG - Intergenic
1082803697 11:57432855-57432877 GCTTCCAAGCAGAGGCTCCCAGG - Intergenic
1083318008 11:61828181-61828203 CCTTCCTGGCGGAGGATCCCTGG - Exonic
1083398048 11:62404862-62404884 CCTACCAGGTAGCTGGGCCCTGG + Intergenic
1083796930 11:65022228-65022250 CCTGCTAGATTGAGGGTCCCAGG - Intronic
1084529712 11:69719687-69719709 CCTGCTAGGTAGAGGTTCCTAGG + Intergenic
1084643982 11:70443714-70443736 CCTTCCTGCTGGAGGCTCCCGGG - Intergenic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1084949179 11:72655215-72655237 CCTTCCAGGAACTGGGGCCCAGG - Intronic
1085448421 11:76616283-76616305 CTTTCCAGGTGGAGGAACCCAGG - Intergenic
1092947680 12:13472043-13472065 TCTTCCAGGTAGAGCTTCACGGG - Intergenic
1092984255 12:13830029-13830051 CCTTCCAGATAGTGGGTCTCAGG - Intronic
1093061573 12:14612871-14612893 TTTTCCAGGTAGAAGCTCCCTGG + Exonic
1094843463 12:34351503-34351525 CCTTGCAGGTGCGGGGTCCCGGG - Intergenic
1096182908 12:49560226-49560248 CCTGTCAGGTAGAGCGCCCCAGG - Intronic
1096413161 12:51391561-51391583 CCTCCCGGGGAGAGGGTCGCGGG + Intronic
1096679118 12:53243025-53243047 ACATCCAGGCAGAGGGTTCCTGG - Intergenic
1098076545 12:66738045-66738067 CCTTCCAGCCAGGGGGTCCCAGG - Intronic
1098140367 12:67444617-67444639 CCTTCCAGGGAAAAGGTGCCAGG - Intergenic
1101854029 12:108427330-108427352 CTCACTAGGTAGAGGGTCCCAGG + Intergenic
1101904807 12:108816642-108816664 CCTCTCAGGCAGAGGGGCCCGGG - Intronic
1103323123 12:120103036-120103058 GCTTCCATGTGGAGGGTGCCAGG - Intronic
1103924419 12:124415669-124415691 CGTTCCAGGCAGGGGCTCCCAGG - Intronic
1103935062 12:124471229-124471251 GCTTCCAGGAAGAGGTGCCCTGG - Intronic
1106342792 13:28847339-28847361 CCTCCCAGATAGAGGGACACAGG + Intronic
1106765866 13:32913561-32913583 GACTCCAGGTACAGGGTCCCAGG - Intergenic
1106983863 13:35321947-35321969 CCACCAAGCTAGAGGGTCCCAGG + Intronic
1107996943 13:45870450-45870472 CATTCCTGGTAGAGGCTCCTGGG + Intergenic
1112009208 13:95279897-95279919 CCTTCCAGGGTGGTGGTCCCAGG - Intronic
1112930548 13:104730966-104730988 CCTCCTAGGAAAAGGGTCCCTGG - Intergenic
1113579386 13:111418343-111418365 CCTCCCAGGATGGGGGTCCCGGG + Intergenic
1114183580 14:20384023-20384045 CCTTCCTGGTACAGAGTCTCAGG - Exonic
1116861878 14:50001789-50001811 CCTTCCACGGAGAGGCTGCCGGG + Intronic
1119831608 14:77707880-77707902 CCTTCCAGGTCTGCGGTCCCGGG + Exonic
1120285500 14:82495454-82495476 CCTTCCAGCTAGATGTGCCCAGG + Intergenic
1121620000 14:95339673-95339695 CCTTCCAGGTTGAGGTGCGCTGG + Intergenic
1121685655 14:95833110-95833132 CCTTCCCTGAAGAGGGTTCCGGG + Intergenic
1122718399 14:103708507-103708529 CCTTACAGGTAGGTGGGCCCTGG - Exonic
1123048768 14:105530777-105530799 CATCACAGGTACAGGGTCCCAGG - Intergenic
1123710111 15:22980541-22980563 CCTCCCAGGCAGAGAGCCCCTGG + Intronic
1127832529 15:62763555-62763577 CCTTCCAGGGACAAGGCCCCTGG + Exonic
1128545148 15:68561486-68561508 CGGGACAGGTAGAGGGTCCCCGG + Intergenic
1129186748 15:73911899-73911921 CACTCCAGGTAGAGCGTCCAAGG - Intergenic
1132784270 16:1646165-1646187 CCTTCCAAGTGGAGGGACCCAGG + Intronic
1132950308 16:2558062-2558084 CCTTCCAGGCAGGAGGTCTCAGG + Intronic
1132964040 16:2642108-2642130 CCTTCCAGGCAGGAGGTCTCAGG - Intergenic
1133030059 16:3006330-3006352 CCTTCTTGGTGGTGGGTCCCGGG - Intergenic
1135182443 16:20287520-20287542 CCTTCAAGTTTGAGGGCCCCTGG - Intergenic
1136276408 16:29181600-29181622 CCTGCCAGCTAGGGAGTCCCCGG + Intergenic
1136617535 16:31407780-31407802 CCTGCCTGGCAGTGGGTCCCTGG - Exonic
1138589827 16:57993688-57993710 CCTCCCAGGAAGAGGATGCCCGG - Intergenic
1138696165 16:58815461-58815483 CCTTTCAGGGAGAGCTTCCCTGG + Intergenic
1140897872 16:79341021-79341043 CCTTCCAGGCAGAGGGACAAAGG + Intergenic
1142080791 16:88147660-88147682 CCTGCCAGCTAGGGAGTCCCTGG + Intergenic
1142410112 16:89911645-89911667 CCTTGTTGGTAGAGGGTCTCAGG + Intergenic
1142889952 17:2936777-2936799 CCTGCAAGGAAGGGGGTCCCGGG - Intronic
1143021001 17:3917183-3917205 CCTTCTAGGTCGAGGCTCACAGG + Intergenic
1143088686 17:4435568-4435590 ACTTCCAGGCAGAGGCCCCCAGG + Intronic
1143332080 17:6144884-6144906 CATCCCAGGTAGAGGTTCCATGG - Intergenic
1143608852 17:8006241-8006263 CCTTCCAGTTAGTTGTTCCCAGG - Intronic
1144014286 17:11179114-11179136 CCTTACAGGTGGAGAGTCCAAGG + Intergenic
1147456786 17:40542866-40542888 CCTGCCAAGCACAGGGTCCCGGG - Intergenic
1148463550 17:47851364-47851386 ACTCCCAGGGAGAGGGGCCCGGG + Intronic
1150768362 17:68020406-68020428 CCTGCCCTGCAGAGGGTCCCGGG - Intergenic
1150819928 17:68426904-68426926 CTTGCCAGGTTGAGGGTCCCAGG + Intronic
1151006524 17:70443778-70443800 CCTTCCAGGAAACTGGTCCCTGG + Intergenic
1151939389 17:77282983-77283005 CCTCCCAGGTCGTGGGTCCTGGG + Intronic
1152351554 17:79786407-79786429 CCCGCCTGGTAGAGGGTCCCGGG + Exonic
1152420106 17:80188115-80188137 CCATCCAGGGTTAGGGTCCCAGG - Intronic
1152794049 17:82298252-82298274 ACTTCCGGGTAGACGGTGCCGGG - Intergenic
1154411120 18:14142824-14142846 CCCTACAGGAAGAAGGTCCCTGG - Intergenic
1155961485 18:31999272-31999294 CATTCCAGATAGAGGGGACCTGG - Intergenic
1156371442 18:36474826-36474848 CATTCCAGCCAGAGGGCCCCAGG - Intronic
1156483957 18:37453100-37453122 CATTCCAGGTAGAGGGAACCCGG - Intronic
1156616752 18:38795446-38795468 CCTTGTAGATAGAGGGTCACTGG + Intergenic
1157424183 18:47570848-47570870 CCTTCTGGGAAGAGGGTACCCGG - Intergenic
1157818802 18:50750588-50750610 CCTTGCAGGCAGACAGTCCCAGG - Intergenic
1159084195 18:63769864-63769886 CCTCCCAGGTAGAGGGTTTGAGG - Intronic
1160668287 19:344060-344082 CATTTCAGATAAAGGGTCCCGGG + Intronic
1160968003 19:1754977-1754999 GCTTCCTGATAGGGGGTCCCGGG - Intronic
1162101694 19:8342922-8342944 CCGTCCCGGGAAAGGGTCCCAGG + Intronic
1162363235 19:10231652-10231674 TCTTCCAAGTCCAGGGTCCCAGG - Intergenic
1162465294 19:10835994-10836016 AATACCAGGTAGAGGGTCGCGGG - Exonic
1163187442 19:15649028-15649050 GCTCCCGGGTAAAGGGTCCCTGG + Intronic
1163695685 19:18762176-18762198 CCTTCCCGCTGGAGGGTCCTTGG + Intronic
1164751388 19:30657586-30657608 CCTTCCAGGAAGAGAGTGCAGGG - Intronic
1165362349 19:35344759-35344781 CCTTCCAGGCAAAGGCTGCCAGG + Intronic
1166641327 19:44497611-44497633 GCTTACAGGTAGATGGTCCAGGG - Intronic
1167200461 19:48061760-48061782 TCTGCCAGGAAGAGGGGCCCGGG + Intronic
1168510588 19:56970586-56970608 CCTGCCAGGCACAGGGTTCCAGG - Intergenic
1168616813 19:57844474-57844496 CCTTCAAGGTAGCAGGACCCAGG - Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925192059 2:1892795-1892817 CCTTTCAGCCAGAGGGGCCCCGG + Intronic
925744177 2:7030675-7030697 CCTTCCACGAAGTGAGTCCCTGG - Intronic
926326151 2:11786257-11786279 CCGTCCAGGAAAAGAGTCCCTGG - Intronic
928379098 2:30802774-30802796 CTTTTCAGGCAGAGGCTCCCAGG - Intronic
935735637 2:106104823-106104845 CCTTCCAGGTATACGGATCCGGG - Exonic
935926387 2:108074397-108074419 CCTTACAGGTTGAGGGTTGCTGG - Intergenic
936098375 2:109552218-109552240 TCTTCCAGGAAACGGGTCCCTGG + Intronic
937267478 2:120625546-120625568 CCTTCCATGTAGAGGGGCAGAGG - Intergenic
946880440 2:224171703-224171725 CTTTCCAAGTGGAGGATCCCTGG + Intergenic
947516894 2:230813812-230813834 CCTTCCATGAAGAGGGCTCCTGG - Intronic
947541812 2:230985137-230985159 CCTTGCAGGGAGAGGATCCCTGG + Intergenic
948452259 2:238083240-238083262 CCTTCCAGTTTTATGGTCCCAGG + Exonic
1172802972 20:37591274-37591296 CCTTCCATGTAGAGGGGTCAAGG - Intergenic
1175568497 20:60000156-60000178 CCTTCCTTGCAGAGGGGCCCCGG - Intronic
1177629077 21:23703266-23703288 CCTTTTAGGAAGAGGCTCCCAGG - Intergenic
1179874638 21:44261802-44261824 GCTTCCAGGCTCAGGGTCCCCGG + Exonic
1180093310 21:45543187-45543209 CCTTCCTGGGAGAGTGGCCCAGG - Intronic
1180185763 21:46138493-46138515 ACCTCCAGGTAGGGGGGCCCGGG - Exonic
1181041670 22:20195316-20195338 CCAGCCAGGTAGAGTGGCCCTGG + Intergenic
1181630897 22:24150831-24150853 TCTGCCAGGAAGAGGGTCACTGG - Intronic
1181667409 22:24407651-24407673 CCTTGCAGGGAGAGGGGGCCAGG - Intronic
1181823306 22:25493070-25493092 CCTTCCAGCTACAGTGTGCCAGG - Intergenic
1183077846 22:35438054-35438076 TCTTCCAGGCAGAAGGACCCAGG + Intergenic
1183725578 22:39587393-39587415 CCTGCCAGGCAGATGGTCCCAGG - Intronic
1184161874 22:42701813-42701835 CCGTCAAGGTAGAGGCTGCCTGG + Intronic
1184841980 22:47057384-47057406 CCTTCCAGGTGCAGGGAACCAGG + Intronic
1185251511 22:49804134-49804156 CCCTCCAGGGAGAGGGCACCTGG - Intronic
949919301 3:8988697-8988719 TCTTCCACGTAAACGGTCCCTGG - Intronic
954078152 3:48196232-48196254 CCTTCCAGAAGGAGGGCCCCAGG - Intergenic
957776495 3:84761300-84761322 TCTCCAAGGTAGAGAGTCCCAGG - Intergenic
961487812 3:127229426-127229448 CCTTCCAGGTAAAGTGGCCTTGG + Intergenic
962271104 3:133978690-133978712 CCATCCAGGAAGAGTGGCCCTGG + Intronic
967467788 3:189827599-189827621 TATTCCAGGTAGAGGGACCAGGG + Intronic
968026526 3:195447223-195447245 CCACACAGGTAGTGGGTCCCTGG + Intergenic
968091538 3:195901196-195901218 CCTTCCCCTTTGAGGGTCCCGGG - Intronic
968904481 4:3445105-3445127 CCTCCCAGGCAGAGGTTCCGGGG - Intronic
973253144 4:48082379-48082401 ACTTCCAGGTAGAAGGTTTCAGG - Intronic
973700102 4:53528771-53528793 CCTTCCAGGGAGATGGTGCCAGG - Intronic
976993263 4:91396920-91396942 GCTTCCAGGTTGAGGGTCAATGG - Intronic
979558744 4:122078904-122078926 CCCTCTATGGAGAGGGTCCCAGG + Intergenic
980679154 4:136133348-136133370 ACTTTCAAGAAGAGGGTCCCTGG + Intergenic
985611544 5:892387-892409 CGTTCCTGGTAGAGGGTTCTGGG - Intronic
986594302 5:9404802-9404824 CCTTCCAGGTGGACTGTCTCAGG + Intronic
987776391 5:22372743-22372765 CCTTCCAGGTGGTGGGCCCACGG + Intronic
988624077 5:32852408-32852430 CCTCCTAGGTAGAGTGTCCTGGG - Intergenic
992570460 5:78050109-78050131 CCTTCCAGGTAGAGGGTCCCAGG - Intronic
992871221 5:81007437-81007459 AGCTCCAGGGAGAGGGTCCCTGG - Intronic
996416973 5:123221164-123221186 CCTTCTATGTAAAGGGGCCCAGG + Intergenic
997695356 5:135857007-135857029 CCTTCCAGGGACAAGGTGCCAGG - Intronic
998444220 5:142186234-142186256 CTTTCCAGGGAGAGGGTCCATGG + Intergenic
999281599 5:150369850-150369872 CCTTCCTGGGAGAGGTGCCCTGG + Intronic
1000337950 5:160255419-160255441 TCTTCCAGCTACAGGGTCTCAGG - Intronic
1002495353 5:179607833-179607855 CCTCCCAGAAAGAGGGTGCCAGG - Intronic
1003392644 6:5726885-5726907 CCTTCCAGGGTGAGCTTCCCGGG + Intronic
1003801072 6:9668139-9668161 CCTTCCAGAGGGATGGTCCCAGG - Intronic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1005511178 6:26512904-26512926 CCTTCCAGGAAAATGGTCACTGG + Intergenic
1006421801 6:33939124-33939146 CCTTCCAGCTCGTGTGTCCCGGG - Intergenic
1007937996 6:45750856-45750878 ACTTCCAGGTAGATGGTGTCAGG + Intergenic
1012171006 6:96016316-96016338 TCCTCCAGGCAGAGGGTCCAGGG + Intronic
1013242621 6:108260596-108260618 CCCTACAGGAAGAGGGGCCCTGG + Intronic
1014802860 6:125796388-125796410 GGTTCCAGGTAGTGGGTTCCAGG + Intronic
1016367675 6:143337067-143337089 CCTTCCAGGCACAGGGTCACAGG + Intronic
1017497674 6:154995676-154995698 CCCTCCGGGGAGAGGGTGCCAGG - Intronic
1018455898 6:163951924-163951946 CCTTCCCGGTCGAGTGTTCCTGG + Intergenic
1018686165 6:166306859-166306881 GCCTCCAGGCAGAGGGTCTCTGG + Exonic
1018731379 6:166653732-166653754 AATTCCAGGTAGCGGCTCCCTGG + Intronic
1019165400 6:170094886-170094908 ATTCCCAGGTAGGGGGTCCCTGG - Intergenic
1021984878 7:26088848-26088870 CATTCCAGGCAGAAGGTCTCTGG - Intergenic
1025613680 7:63099955-63099977 CCTTCCAGTGAGAAGGTCCAGGG + Intergenic
1027049960 7:75015725-75015747 CCTTCCAGGTCCAGGGTTTCTGG + Intronic
1029474527 7:100775268-100775290 TCTGGCAGGTACAGGGTCCCTGG - Intronic
1029585279 7:101466917-101466939 CCTGTCAGGTAGAGGGTGCCAGG + Intronic
1029726646 7:102410436-102410458 CCTTGCAGGTAGACGTTTCCAGG + Intronic
1029960342 7:104683612-104683634 GCTTCCAGGAAGTGGGTTCCAGG + Intronic
1030923683 7:115424280-115424302 CCTTCTAGGTCTAGGGCCCCAGG + Intergenic
1033996936 7:147362044-147362066 CCTTCCAACTAGAGAGTCTCAGG + Intronic
1034122615 7:148641119-148641141 GCTTCCAGGTAGAGAACCCCTGG + Intergenic
1034417232 7:150971563-150971585 CCTTCCAGATAGAGGCTCCGAGG + Intronic
1035371652 7:158382972-158382994 TCTTCCAGGAAGCTGGTCCCTGG + Intronic
1037716567 8:21406206-21406228 CCGTGCAGGCTGAGGGTCCCTGG - Intergenic
1037768506 8:21785932-21785954 CCTGCCAGGAAAAGGGCCCCAGG + Intronic
1039542929 8:38386496-38386518 CCTTCTAGCTTGGGGGTCCCGGG + Exonic
1042739602 8:72028360-72028382 CCTTCCAGGCAAAGGGGCCTTGG + Intronic
1048211420 8:132457448-132457470 ACTTCCATATAAAGGGTCCCTGG + Intronic
1049644921 8:143731910-143731932 CCTTCCAGGGAGAGGTACCCAGG - Intronic
1055197623 9:73615570-73615592 CCTTCCAGGGAGAAGGTACAAGG + Intergenic
1055412761 9:76049054-76049076 GCTCTCAGGTAGAGGGTCACTGG - Intronic
1055482843 9:76726875-76726897 CCTTCCAGGCAGAGAATACCTGG + Intronic
1056762389 9:89424759-89424781 CCTTACAGGTAGCGGGAGCCAGG - Intronic
1057263488 9:93599120-93599142 TCTCCCTGGCAGAGGGTCCCTGG - Intronic
1057876169 9:98756112-98756134 CCTGACAGGTACAGGGTCCAGGG + Intronic
1060942250 9:127549735-127549757 CTATCCATGTAAAGGGTCCCTGG - Intronic
1061296720 9:129680755-129680777 CCTTCCAGAGAGGGGATCCCAGG - Intronic
1061724221 9:132572710-132572732 GGCTCCAGGTAGAGGGTCACTGG - Exonic
1062323942 9:136003721-136003743 CCTGCCTGGGAGAGGGGCCCTGG + Intergenic
1062338195 9:136081774-136081796 CCATCCAGGTAGAGGGAGCTTGG - Intronic
1062371635 9:136242295-136242317 CCTTCCAGCTGGAGGCTCCTGGG + Intronic
1192929020 X:75785143-75785165 CCTTCCAGCTCCAGGGTCTCGGG - Exonic
1196009501 X:110871944-110871966 TCTGACAGGTAGAGGATCCCAGG + Intergenic
1198395463 X:136214813-136214835 CCCTCCGGGTAGAGGATACCAGG + Intronic
1199853089 X:151739127-151739149 CCTTCCCGGTAGAGAGACCTAGG + Intronic
1199871191 X:151900343-151900365 GCCTCCAGGTAGAGGGACCTGGG + Intergenic