ID: 992570959

View in Genome Browser
Species Human (GRCh38)
Location 5:78056926-78056948
Sequence TTGGCTATGGCAGCATTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992570955_992570959 3 Left 992570955 5:78056900-78056922 CCGAAAATGGACAAGCCAACATA 0: 1
1: 0
2: 0
3: 18
4: 182
Right 992570959 5:78056926-78056948 TTGGCTATGGCAGCATTTGTTGG 0: 1
1: 0
2: 2
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992570959 Original CRISPR TTGGCTATGGCAGCATTTGT TGG Intronic
903313795 1:22483810-22483832 TTGGCTATGGCAGTCTTTTTAGG - Intronic
906005792 1:42468905-42468927 CTGGAAATGGCAGCATTTGAAGG + Intronic
908709307 1:66997042-66997064 TTGGATTTGGCAGCATATCTTGG + Intergenic
917035237 1:170741586-170741608 CTGGCTCTGGCAGCATATCTCGG - Intergenic
917340477 1:173972232-173972254 TTGGATATGGCAGCATTTGATGG - Intronic
918995693 1:191756642-191756664 ATGTCTTTGGCAGCACTTGTTGG - Intergenic
920576691 1:207066149-207066171 GTTACTATGGAAGCATTTGTTGG + Intronic
921297855 1:213721663-213721685 TGAGCTATGGCAGCAGTTTTGGG - Intergenic
922471070 1:225877653-225877675 TTGGCTCTGCCAGCACTGGTGGG - Intronic
924565737 1:245196613-245196635 TTGGCTATGGCAGTGGTTCTCGG - Intronic
1065279644 10:24121821-24121843 TTGGTTATGGGGGCATTTTTAGG + Intronic
1066192960 10:33072592-33072614 TTGGGTCTGGAAGCAGTTGTGGG - Intergenic
1067799216 10:49347485-49347507 TCAGCTAGGGCAGCATTTGTTGG + Intergenic
1067858114 10:49815245-49815267 TTTGCCATGGGAACATTTGTGGG - Intergenic
1069085851 10:64138682-64138704 TTGCTTAAGGCAGTATTTGTTGG + Intergenic
1070671073 10:78377576-78377598 TTGGCTATGGAGGGCTTTGTAGG + Intergenic
1072478363 10:95785464-95785486 TTGGCTTAAGCAGCAGTTGTTGG + Intronic
1074834000 10:117271966-117271988 TGGGCTACAGGAGCATTTGTAGG - Intronic
1080948621 11:37003174-37003196 TTGCTTATGGCAGGATTTCTTGG - Intergenic
1081661041 11:44888592-44888614 TTGGCTTGGGCTGCATTTGGAGG + Intronic
1082631376 11:55546083-55546105 CTGGGTATGGCAGCACTTGCTGG - Intergenic
1085571388 11:77560924-77560946 TTGGCTTGGGCTGCATGTGTGGG - Intronic
1085602628 11:77869013-77869035 TTTGCCATGGTAACATTTGTGGG + Intronic
1088191516 11:107233534-107233556 TTCGGTATGGCACCATTTCTTGG - Intergenic
1091624144 12:2109735-2109757 GTGGCTACTGCAGCACTTGTGGG + Intronic
1091830896 12:3550713-3550735 TTGGCTGTGGCAGCGTTTCCAGG + Intronic
1093641762 12:21535089-21535111 CTGGCTTTGGCAGTATGTGTAGG - Intronic
1094261712 12:28508025-28508047 TTGGCCAAGGTAGCAGTTGTTGG + Intronic
1097322770 12:58244540-58244562 TTTGCCATGGCAGCATTAGTGGG - Intergenic
1097438953 12:59585998-59586020 TGAGCTAGGGCAGTATTTGTAGG + Intergenic
1097559729 12:61188576-61188598 TTGGCTAGGGCAGAATTTCTCGG - Intergenic
1097607688 12:61776077-61776099 TTTGCCATGGTAGCATTAGTGGG - Intronic
1097729349 12:63109942-63109964 TAGGGAATGGCAGGATTTGTTGG - Intergenic
1098892732 12:76026058-76026080 TTGGTTATGGAATCATGTGTTGG - Exonic
1099016028 12:77345288-77345310 GTGGCTGGGTCAGCATTTGTGGG + Intergenic
1099893676 12:88619095-88619117 TTGACTTTGGCGGCATTTGCTGG - Intergenic
1101236478 12:102794928-102794950 TTGGTTCTGGCAGCATTTAGGGG + Intergenic
1102586091 12:113924010-113924032 TTTGGTTTGGCAGGATTTGTAGG - Intronic
1103144392 12:118582023-118582045 TTGTTTTTGGCAGGATTTGTTGG + Intergenic
1109712330 13:66177930-66177952 TTGGCTATTGCAGCAATTCTCGG + Intergenic
1113411010 13:110089885-110089907 ATGGCTATGTTGGCATTTGTGGG + Intergenic
1117328655 14:54691315-54691337 TTGGCTTTGGCCACATTGGTGGG - Intronic
1117828809 14:59730027-59730049 AAGGCTTTGGCATCATTTGTCGG + Intronic
1118994875 14:70826701-70826723 TTGGCTATAGGAGCAGTTCTTGG - Intergenic
1119828920 14:77683499-77683521 TTTGCCATGGCAACATTTATGGG + Intronic
1120494954 14:85223410-85223432 TTAACTATAGCAGCAATTGTTGG - Intergenic
1122794984 14:104201545-104201567 TTGTCTCTGGCAGCACCTGTGGG - Intergenic
1125038746 15:35158289-35158311 TTGGCTATATAAGCATTTGGGGG + Intergenic
1129325096 15:74795659-74795681 TTGGCTAGGGTAGCTTTTTTGGG + Intronic
1132900913 16:2253844-2253866 TTGACTCTGGCAGGATTTGCAGG - Exonic
1133672461 16:8036418-8036440 TTGGCTATTGTTGGATTTGTTGG + Intergenic
1135341999 16:21656508-21656530 TCCTCTATGGCAGCATTTCTGGG - Exonic
1136672472 16:31871116-31871138 TCCGCTATGGCAGAATTTGAAGG - Intergenic
1139561290 16:67744016-67744038 TTGGCTTTGGTGGCACTTGTTGG - Intronic
1144354129 17:14428027-14428049 TTAGCTATGCCAGGATTTCTAGG + Intergenic
1145152004 17:20517258-20517280 GTGGCTATGGCAGCAGCTTTGGG - Intergenic
1146163374 17:30571529-30571551 GTGGCTATGGCAGCAGCTTTGGG - Intergenic
1147399792 17:40173755-40173777 ATGGAGCTGGCAGCATTTGTTGG + Intergenic
1147580347 17:41624288-41624310 GTGGCTATGGCAGCAGCTTTGGG - Exonic
1153766259 18:8377933-8377955 TTGTCTATGGTAGGATTTGCTGG - Intronic
1156420115 18:36942948-36942970 TTTGCTTTGGCATCATTTCTAGG - Intronic
1156621081 18:38852801-38852823 TTGGCTATGGGAGGATTTACTGG + Intergenic
1156644791 18:39147998-39148020 ATGCCTTTGGCACCATTTGTTGG + Intergenic
1158228868 18:55231104-55231126 TTGGCACTGGCAGCAGTTGGGGG - Intronic
1158919745 18:62178171-62178193 GTGGCAATGGCAGCAGCTGTGGG - Intronic
1162194974 19:8977498-8977520 TTTCCTATGGCACCACTTGTTGG + Exonic
1166174877 19:41060559-41060581 TTGGCTATGAGAGCTTTAGTGGG + Intergenic
927024735 2:19054738-19054760 TTGGCTATGTGCGCATTTTTTGG + Intergenic
927307860 2:21594441-21594463 TTGACTTTTGCAGCATTTGATGG + Intergenic
938585035 2:132682180-132682202 TAGTTTATGGCAGCAATTGTAGG + Intronic
940075258 2:149734426-149734448 TTGGCAATGGCAGGACTAGTTGG + Intergenic
941279868 2:163536576-163536598 ATGGCTTTGACACCATTTGTTGG + Intergenic
941661376 2:168199028-168199050 TTTGCTATGGCATCATATTTTGG + Intronic
942523758 2:176831274-176831296 TAGGCTGATGCAGCATTTGTTGG + Intergenic
943875957 2:193067604-193067626 TTGGCTATTGAAGCAATTTTTGG + Intergenic
944476300 2:200110310-200110332 TTTGCAATGGGAGCATTCGTTGG - Intergenic
945378973 2:209116377-209116399 TTGGCTGAGGCAGTATTTGAGGG - Intergenic
945524422 2:210870586-210870608 TTGGCTATATGAGCATTTTTTGG - Intergenic
948327018 2:237132535-237132557 TGGGCTATGGAAGCAGTTATGGG + Intergenic
1170158687 20:13291259-13291281 CTGGCTATTGCAGCTTTTCTGGG + Intronic
1174994761 20:55553614-55553636 TTAGCAATGCCGGCATTTGTGGG + Intergenic
1178410515 21:32359959-32359981 CTGGCCAGGGCAGCAATTGTTGG - Intronic
1179236659 21:39553500-39553522 CTGCCATTGGCAGCATTTGTTGG - Intergenic
1180032194 21:45219912-45219934 CAGGCCATGGCAGCATTTTTGGG - Intronic
949417998 3:3833756-3833778 AGGCCTATGGCAGCATGTGTTGG + Intronic
949714415 3:6912346-6912368 TTGGCTATGCAAACCTTTGTTGG + Intronic
950853273 3:16082821-16082843 GTGGCAATGGCAGCAGTGGTGGG + Intergenic
954008911 3:47617427-47617449 TTGGCTTTGTGAGCATTTATTGG - Intronic
955096972 3:55808312-55808334 TTGCCTATGGCTGTTTTTGTTGG + Intronic
955759690 3:62265697-62265719 TTGACTTTGGCAGTATTTGTTGG + Intronic
955854130 3:63255064-63255086 TTTGTTATGGCAGCCCTTGTTGG + Intronic
960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG + Exonic
961549820 3:127662813-127662835 TTTGCAATGGCAGCATTGTTAGG + Intronic
962413553 3:135162242-135162264 TTGGCTAGTGCAGCATCTTTGGG - Intronic
964130108 3:153276984-153277006 TGGGCTCTGGCAGTAATTGTAGG + Intergenic
964192746 3:154023992-154024014 TTTGCCATGGTAGCACTTGTGGG - Intergenic
964423915 3:156532404-156532426 GTGGCTATGGCAGGAATTGTGGG - Intronic
970001928 4:11372990-11373012 TTGACTCTGGCAGGATTTGCAGG + Intergenic
970790491 4:19852600-19852622 ATGGCTATGACAGAATTTCTTGG - Intergenic
971006310 4:22377638-22377660 TTGGCTATAGGGGCATTTTTTGG + Intronic
971486980 4:27170587-27170609 TTGGCTCCTTCAGCATTTGTGGG + Intergenic
972319923 4:37964235-37964257 TTAGTTAAAGCAGCATTTGTTGG + Intronic
973118565 4:46490005-46490027 TTTGATATGGCACCATTTCTTGG + Intergenic
973991364 4:56411558-56411580 TTGTCTGTGGAAGCATTAGTAGG + Intronic
975018865 4:69462281-69462303 TTGGATATGGCTGCAATTATTGG + Intergenic
977339351 4:95738885-95738907 AGGGCTATGGCAGCAACTGTGGG + Intergenic
979708138 4:123746037-123746059 TTTGCTATGGCAACATTTGTGGG + Intergenic
982721105 4:158861083-158861105 TTGTCTATGGCTGCTTCTGTGGG - Intronic
985834297 5:2259538-2259560 TTGACCCTGGCAGCATTTCTGGG + Intergenic
986058254 5:4161291-4161313 TTGGCTAGGGGAGCATATTTTGG - Intergenic
992570959 5:78056926-78056948 TTGGCTATGGCAGCATTTGTTGG + Intronic
992725575 5:79603757-79603779 TTGTCTTTGGCATTATTTGTGGG + Intergenic
993145840 5:84092891-84092913 TGGGCTTGGGCAGTATTTGTAGG - Intronic
995424544 5:112005561-112005583 TTGGCTTTGGCAGCAGGTTTGGG - Intergenic
999764563 5:154729381-154729403 TTTGCCATGGTAACATTTGTGGG - Intronic
1000814593 5:165905291-165905313 TTTGCCATGGTAACATTTGTGGG - Intergenic
1001194216 5:169656788-169656810 CTGACTATGGCAGCCTGTGTGGG - Intronic
1002382439 5:178840284-178840306 TTGGCTCTGGCTGCCTTTGTGGG - Intergenic
1002382756 5:178842045-178842067 TTGGCTCTGGCTGCCTTTGTGGG + Intergenic
1002648138 5:180672392-180672414 TTGGCTCTGGCTGCCTTTGGGGG + Intergenic
1003291851 6:4786695-4786717 CTGGTTGTGGGAGCATTTGTAGG + Intronic
1003693291 6:8376141-8376163 CTGGCTGTGGGAGCATATGTAGG - Intergenic
1007056126 6:38886974-38886996 TTGTCTATTGAAGCATTTGAAGG - Exonic
1007646563 6:43386583-43386605 TTTTCTATGTCAGGATTTGTTGG - Intergenic
1010674998 6:78732845-78732867 TTGGCTATTTCAGCTTTTTTTGG - Intergenic
1012950489 6:105512967-105512989 GTGACAATGCCAGCATTTGTGGG + Intergenic
1018322428 6:162626046-162626068 TTGTATTTGGCAGCATATGTGGG - Intronic
1018739264 6:166714882-166714904 TTGGCTTTGGCAGCCTGTGCTGG + Intronic
1022494233 7:30843298-30843320 GTGGTTAGGGCAGCATTTGGAGG + Intronic
1024593828 7:50915575-50915597 TTGGCTAAGGAAGCATAGGTTGG - Intergenic
1024866552 7:53910286-53910308 TGGGCTGGGGCAGCATGTGTGGG - Intergenic
1028068763 7:86422577-86422599 TTGGTTATGGCTGCTTTTGAGGG + Intergenic
1029863857 7:103604229-103604251 TTGGCTATGTCATTATTTATCGG + Intronic
1038851763 8:31285609-31285631 TTGTTTATGGCTGCTTTTGTAGG - Intergenic
1039747919 8:40447834-40447856 TTGCCTGTGGCTGCATGTGTAGG + Intergenic
1046219052 8:111189395-111189417 TTGTCTATGGGATCATGTGTAGG + Intergenic
1046429999 8:114112724-114112746 TTGGCTATGGCAGCCTGTCTAGG + Intergenic
1047559290 8:125969104-125969126 TTTGTTATGGCAGCCTTAGTAGG + Intergenic
1047733326 8:127744633-127744655 TTGGCAAAGCCAGCATTTCTGGG - Intergenic
1047783703 8:128133189-128133211 TTGGAGCAGGCAGCATTTGTGGG - Intergenic
1048273214 8:133045872-133045894 TGTGCTGTGGCAGCATTGGTGGG - Intronic
1055696777 9:78893374-78893396 TTGGTAATGGCAGTATTTGATGG - Intergenic
1056911711 9:90707017-90707039 CTGGATATGGCAGCCTGTGTTGG + Intergenic
1058544045 9:106041796-106041818 TTTGATATGGCACCATTTTTGGG - Intergenic
1058638487 9:107059844-107059866 TTTGCCATGGCACCATTTGGAGG + Intergenic
1058862875 9:109134352-109134374 TGTGCTATGGGAGCATTTGATGG + Exonic
1060119260 9:120972876-120972898 TAGAATATAGCAGCATTTGTTGG + Intronic
1060194922 9:121617373-121617395 TTAGCTAGGGGAGCATTTCTAGG - Intronic
1060550673 9:124483592-124483614 TTGGTTATGGCAGCAATGGTTGG - Intronic
1061043979 9:128154420-128154442 GAGGCTTTGGCAGCATTTGGTGG - Intergenic
1061740848 9:132704988-132705010 TTGGCTGTGGCAGAAGTTTTAGG - Intergenic
1187811747 X:23186578-23186600 TTGCCTATGGCTGCTTTAGTGGG - Intergenic
1191210477 X:57879537-57879559 TTGGCTTTGGCAAAATTTTTTGG + Intergenic
1191693219 X:63962080-63962102 ATGTCTGTGGCAGCAATTGTAGG - Intergenic
1192013823 X:67305966-67305988 TTGCCTATGGATGCATTTATAGG - Intergenic
1192890008 X:75380370-75380392 TTGGCTATTTCAGAATTTTTAGG + Intronic
1192905484 X:75546356-75546378 TCAGCTATGTCAGCATTGGTGGG + Intergenic
1198691666 X:139291464-139291486 TTGACTATGGCAGCATTGACAGG - Intergenic
1199185725 X:144912613-144912635 TGGGTTCTGGCAGCATTTGCTGG - Intergenic
1199294337 X:146140367-146140389 TTCGCTGTTTCAGCATTTGTAGG + Intergenic