ID: 992572617

View in Genome Browser
Species Human (GRCh38)
Location 5:78075413-78075435
Sequence GCCTTTCCTTTGTTTTGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992572617_992572623 27 Left 992572617 5:78075413-78075435 CCATACCAAAACAAAGGAAAGGC 0: 1
1: 0
2: 0
3: 13
4: 276
Right 992572623 5:78075463-78075485 GAGTTCCTACAACACAAACTGGG 0: 1
1: 0
2: 0
3: 4
4: 123
992572617_992572622 26 Left 992572617 5:78075413-78075435 CCATACCAAAACAAAGGAAAGGC 0: 1
1: 0
2: 0
3: 13
4: 276
Right 992572622 5:78075462-78075484 TGAGTTCCTACAACACAAACTGG 0: 1
1: 0
2: 1
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992572617 Original CRISPR GCCTTTCCTTTGTTTTGGTA TGG (reversed) Intronic
901907121 1:12422876-12422898 GTTTTTCCTTTGTGTTTGTAAGG + Intronic
906390460 1:45411008-45411030 GCCTTTCCTTAGTTTTACAAAGG - Intronic
906634662 1:47401086-47401108 GCCTTTACTCTGATTTGGGAAGG - Intergenic
907127959 1:52068686-52068708 ACCTTCCCTTTTTTTTGGTGGGG - Intronic
907494106 1:54830956-54830978 TCCTTTACTTTGTTTTAGTGAGG + Intronic
908610846 1:65858832-65858854 GCCTTTGTTTTGTTTTAATAGGG + Intronic
908775658 1:67637523-67637545 GCCTTTCCTTAGTGTTTGCAAGG - Intergenic
910042801 1:82873901-82873923 GCCTTCCCTCTTTTTTGCTAAGG - Intergenic
911434838 1:97844502-97844524 CCCTTTCTTTTGTTTTTATAAGG - Intronic
911465378 1:98245910-98245932 GCCTTTTTTTTGTTTTGGTTTGG - Intergenic
913652038 1:120925570-120925592 GCCTTTCCTTTCTTCTGTTTTGG + Intergenic
917814556 1:178694261-178694283 TCCTTTCCTTTTTTTTGAGATGG + Intergenic
919523736 1:198621495-198621517 GCCTTTCCTTCGTCTTACTATGG - Intergenic
920591123 1:207220216-207220238 GCTTTTGTTTTGCTTTGGTAAGG + Intergenic
921745504 1:218735862-218735884 GCCTTTTCTTTCTTTAGGTCAGG - Intergenic
922902815 1:229150622-229150644 GCCTTTCCCTTGTGTTGAGATGG + Intergenic
924134047 1:240944717-240944739 TCCTTTCTTTTGTTTTGAGATGG + Intronic
1063742810 10:8842741-8842763 GCCTTTCCTTTATATAGCTAGGG - Intergenic
1064067038 10:12191082-12191104 GCCTTTCCTTTGTTTTTTAAAGG - Intronic
1065260681 10:23920343-23920365 CTCTGTCCTTTCTTTTGGTAAGG + Intronic
1065682647 10:28252902-28252924 GCATTTCTTTTTTTTTGGGAGGG + Intronic
1068617387 10:59134363-59134385 GCCTTTTCATTGTTTTGCTGAGG - Intergenic
1069392472 10:67950985-67951007 GCATTTCCTTACATTTGGTACGG - Intronic
1070074916 10:73125686-73125708 TCCTTTCCTTTTTTTTGAGATGG + Intronic
1071142783 10:82530678-82530700 GTCTTTCCTTTATTTTTGCAGGG - Intronic
1071491688 10:86140635-86140657 GCTTTCCCTTTGTAGTGGTAAGG - Intronic
1071605877 10:86988632-86988654 GTCTTTAATTTGTTTTGGTTTGG + Intergenic
1073496173 10:103893125-103893147 CCCTTTTCTTTGTTTTAGGAAGG - Intronic
1073518736 10:104104392-104104414 TCCTTCCCTTTGATTTAGTAAGG + Intergenic
1075628106 10:123978652-123978674 GCCTTTCATTAGTTTTGCAAAGG + Intergenic
1076112720 10:127873213-127873235 GCCTCTCCTTGGTTGTGGCATGG + Intergenic
1077708680 11:4514083-4514105 GCCGTTCCGTTATTTTGGTGTGG + Intergenic
1078146579 11:8725797-8725819 TCCTTTCCTTTATTTTTGGAAGG - Intronic
1080813904 11:35735138-35735160 GCCTTGCCTTTTTATTTGTATGG - Intronic
1080956619 11:37104499-37104521 TCCTTTCCTTTTTCTTGGCATGG + Intergenic
1085565722 11:77511926-77511948 ACCTTGCCTTTGTGTTGGGATGG - Intergenic
1086037354 11:82432571-82432593 TCCTCTCCTGTCTTTTGGTAAGG - Intergenic
1088581673 11:111322337-111322359 GCCTTTCCATTTTTTTGGGGGGG - Intergenic
1088864477 11:113834572-113834594 GCTTTTGTTTTGTTTTGGTTTGG + Intronic
1089665850 11:120018404-120018426 GACTTGCCTTTGTCTTGATAGGG + Intergenic
1091200143 11:133772456-133772478 GCATTTTCTTTGTTATGGGAGGG - Intergenic
1091581567 12:1793623-1793645 GCCTGACCTGTGTTTTGGCAAGG - Exonic
1091730033 12:2873917-2873939 GCCTTTCCTCTGTAGTGGCAAGG - Intronic
1092658900 12:10717792-10717814 GACTTTTCTTTTTTTTGCTAAGG + Intronic
1093539308 12:20262005-20262027 GCTTTTCCTTTGCTTTCCTATGG - Intergenic
1094454568 12:30618261-30618283 GCCTCTCCTGTGTTCTTGTATGG + Intergenic
1096245985 12:49986799-49986821 GCTTTTGTTTTGTTATGGTAGGG - Intronic
1096305494 12:50471184-50471206 GCCTTCAACTTGTTTTGGTATGG - Intronic
1101025001 12:100593564-100593586 GGCTTTCTTTTGTTTTGGGCTGG + Intronic
1101045125 12:100797276-100797298 GCTTTTTTTTTTTTTTGGTAAGG + Intronic
1103284464 12:119788661-119788683 GCCTTTCGTTTTTTTTGGTGGGG - Intronic
1104337877 12:127917699-127917721 GCTTTTCTTTTGTTTGGGTTGGG + Intergenic
1107237133 13:38185303-38185325 TACTTTCCTATATTTTGGTATGG + Intergenic
1108845986 13:54678948-54678970 GGCTTTCCTTAGTTTTGCAAGGG - Intergenic
1109604309 13:64672173-64672195 TACTTTGCTTTGTTTTGGTTTGG - Intergenic
1112431649 13:99355610-99355632 CCTTTTCCTGTGTTTTGGTTTGG - Intronic
1112682693 13:101785367-101785389 GCTTTTGCTTTGTTTTGGTTTGG - Intronic
1113302814 13:109040964-109040986 GTCTTTCCTTTCTTTTTTTATGG - Intronic
1115595588 14:34905846-34905868 CCTTTTCCTTTCTTTTGCTAAGG + Intergenic
1115811807 14:37118046-37118068 GCCTTTCATTAGTTTTGCAAAGG - Intronic
1115922589 14:38393041-38393063 GCCTTTCCTCTGTGTCAGTATGG + Intergenic
1116622034 14:47217348-47217370 GCCCTTGCTTTGTTTCGGTGGGG + Intronic
1116674363 14:47886796-47886818 GTCTTTCCTGTGTATGGGTAGGG + Intergenic
1118267699 14:64310784-64310806 TACTTTCCTTTGCTTTAGTAAGG + Intronic
1119397719 14:74339938-74339960 GCCTTTTCTTTTTTTTGAGATGG + Intronic
1120908676 14:89644904-89644926 GCCCTTGCTTTGTTTTGTTTGGG - Intergenic
1121123633 14:91392288-91392310 GCTTTTGTTTTGTTTTGGCAGGG - Intronic
1121421592 14:93819346-93819368 GCCTTTCCCTTGCTCTGGAATGG + Intergenic
1122895540 14:104754910-104754932 GCCTTTACTGTGTTATGGTGAGG + Intronic
1124072714 15:26410903-26410925 GCCTTTCTTTTGATGTGGAAAGG - Intergenic
1124353359 15:28976793-28976815 GCCTTTCATTGGTTTTAGTGTGG + Intronic
1124818945 15:33023432-33023454 TTCTTGCCTTTATTTTGGTAAGG - Intronic
1125342263 15:38686559-38686581 GCTCTTCCTGTGTTTTAGTACGG + Intergenic
1125431509 15:39599364-39599386 GCCTTTCTGTTATTTAGGTAAGG - Exonic
1126163031 15:45631626-45631648 GCCTTCCCTTTCTTGTGATAAGG + Intronic
1126254529 15:46609730-46609752 GATTTTCTTTTATTTTGGTAAGG + Intergenic
1126396004 15:48218340-48218362 GCATTTTCTTTGTCTTTGTAAGG - Intronic
1127416698 15:58765036-58765058 GCCTTTTTTTTTTTTTGATATGG - Intergenic
1128944173 15:71810285-71810307 TCTTTTTCTTTGTTTTGATACGG - Intronic
1130225830 15:82057868-82057890 GCTTTTCCTTGTTTTCGGTAAGG + Intergenic
1130452543 15:84071072-84071094 GCCTCTACATGGTTTTGGTAAGG + Intergenic
1133098166 16:3461757-3461779 GCCTTTCTTTTGTTTTTCTGTGG - Intronic
1133266752 16:4589412-4589434 GCTTTTTTTTTTTTTTGGTAGGG - Intronic
1134017084 16:10896201-10896223 GTATTTCCTTTGTTGTTGTAAGG - Intronic
1134766639 16:16764532-16764554 GCCTTTCTATTGTTTTTATAAGG - Intergenic
1135073568 16:19373625-19373647 GCCTCTCCTTTCTATTGATAAGG - Intergenic
1135356367 16:21772415-21772437 GCCTTTCCTTAGTTTTACAAAGG + Intergenic
1135454859 16:22588559-22588581 GCCTTTCCTTAGTTTTACAAAGG + Intergenic
1136028825 16:27488175-27488197 GCCTTGTCTTTGTTTTGGCTTGG - Intronic
1138583229 16:57955122-57955144 GCCTTCCCCTTGTTCTGGTCTGG + Intronic
1141097000 16:81170062-81170084 GCCTTTGTTTTGTTTTTGAAGGG + Intergenic
1143259480 17:5587268-5587290 GTCTTTCCATTGTCTTGGAATGG + Intronic
1143729024 17:8869831-8869853 GCCTTGCCTTGGTGATGGTAGGG - Intergenic
1145067460 17:19771525-19771547 GCTTTTGTTTTGTTTTGGGAGGG - Intronic
1146939860 17:36836878-36836900 GCCTTTCTTTTTTTTTGAGATGG - Intergenic
1147292536 17:39455576-39455598 GCCTGGCCTTTTTTTTGGGATGG - Intergenic
1148089050 17:45011761-45011783 GCCTTTCTTTTTTTTTGAAACGG - Intergenic
1148566297 17:48634893-48634915 GATTTTCCTTCGTTTTGGTTCGG - Intergenic
1149888951 17:60368830-60368852 GACTTTTATTTGTTTTGGTTTGG - Intronic
1151059891 17:71079854-71079876 GCTTTTGTTTTGTTTTGGTTTGG - Intergenic
1152836509 17:82536400-82536422 TCCTTTCCTTGGGTTTGGTGGGG + Intronic
1153720999 18:7902853-7902875 TACTCTCCTTTGCTTTGGTAAGG + Intronic
1153846461 18:9053857-9053879 GCCTTTCATTAGTTTTACTAAGG + Intergenic
1156817169 18:41325348-41325370 GCCTTTCATTTGTCTTAGAAAGG + Intergenic
1156902776 18:42320808-42320830 GCATCTCCTTTGTTTTGCTTTGG - Intergenic
1159013070 18:63076870-63076892 GCCTTTTCTTGGTTTTAATAGGG + Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1163859812 19:19736553-19736575 GCCTTTCTTTTTTTTTGAGACGG + Intergenic
1165579075 19:36846830-36846852 GCCTCTCCCTGTTTTTGGTAAGG - Intronic
1167149433 19:47700344-47700366 GCCTTTCTTTTTTTTTGAGACGG - Intronic
1167441414 19:49511487-49511509 TCCTTTCCTTTTTTTTGACAGGG - Intronic
1168396347 19:56052182-56052204 TGCTTTGCTTTGTTTTGGTTTGG + Intronic
925516563 2:4690071-4690093 TCCTTTACTTTATTTTGGAATGG - Intergenic
925584253 2:5447216-5447238 GCCTTTCATTTCTTTTGAAAAGG - Intergenic
929642272 2:43593995-43594017 GCTTTTCCTTTGTATTGATCTGG - Intronic
931007261 2:57866023-57866045 GTTTTTCCTTTCTTTTGCTAAGG + Intergenic
931229596 2:60363236-60363258 GCCTTGGCTGTGTTTTGATATGG - Intergenic
931804473 2:65790595-65790617 GCATTTACCTTGTTTTGGTTTGG + Intergenic
932071297 2:68623201-68623223 GCTTTTTCTTTGTTTAAGTAGGG + Intronic
932079068 2:68694897-68694919 GTCTTTCATTAGTTTTGCTATGG - Intronic
932944381 2:76210343-76210365 TCCTTTCTTTTATTTTGATAAGG - Intergenic
933463466 2:82619809-82619831 GCCTTTTCTTTCTATTGGTTGGG - Intergenic
935008247 2:99103462-99103484 GCCTTTCCTGTGTACTGGCATGG - Intronic
935801837 2:106705421-106705443 GACTTTCATTTGTTTAGGGATGG - Intergenic
936018504 2:108977271-108977293 GCCTTTTCTTTTTTTTGAGATGG + Intronic
936739782 2:115491160-115491182 TTCTTTCGTTTGGTTTGGTATGG - Intronic
937709966 2:124969293-124969315 GTCTGTCCTTTGTTTTGGATGGG + Intergenic
939076292 2:137606491-137606513 CCCTTTTCTTTGGTTTGGTAGGG + Intronic
942257808 2:174123541-174123563 GCCTTTGCTTTCATTTGCTAGGG - Intronic
942454011 2:176125313-176125335 GCCTTTCCCTTGTTTGGAGAGGG - Intergenic
942729729 2:179051202-179051224 TCCATTGCTTTGTTTTGCTAAGG + Intergenic
944126149 2:196294978-196295000 TCCTTTAATTTGTTTTGATAGGG - Intronic
946971373 2:225095524-225095546 GCTTTTTCTTTGTTTTGTTTTGG + Intergenic
947302040 2:228698723-228698745 GGCTTTCCTTTGTTTCAATATGG + Intergenic
947568993 2:231216136-231216158 TCCTTTCCTTTCTTGTGCTAAGG - Intronic
1169778035 20:9277311-9277333 GCTTTTCCTCTGTTTTGTTCAGG - Intronic
1170005548 20:11664925-11664947 GCCTTCCTTCTGTTCTGGTATGG + Intergenic
1171454506 20:25259995-25260017 GCCTTTGCTTTGCTTGGGTTTGG + Intronic
1172103230 20:32498254-32498276 GCATTTCCTCTGTTTTGTGAGGG - Intronic
1173083851 20:39895704-39895726 TCTTTTCCTTTGTTTTTGCAGGG - Intergenic
1175380267 20:58557960-58557982 GCCTTTCCTTTGCCTTGGGCTGG + Intergenic
1176957820 21:15126494-15126516 TCCTTTTCTTTCTTTTGGTGGGG - Intergenic
1177925762 21:27212634-27212656 GCATTTCCTTGGGTGTGGTAGGG + Intergenic
1178991105 21:37357490-37357512 GCCTTTCATTTATTTTTGAAAGG + Intergenic
1179130804 21:38635699-38635721 ACCTTTTCTGTGTTTAGGTAAGG + Intronic
1182947052 22:34333670-34333692 GCCTTCCTTTTTTTATGGTATGG + Intergenic
1184520104 22:44988453-44988475 CCCTTTCCTTTCTTTTGACAGGG - Intronic
950352696 3:12372612-12372634 GCTTTTCTTTTCTTTTCGTAAGG + Intronic
950589850 3:13929427-13929449 GCCTTGCCTTTCTCTTGGAATGG + Intergenic
953799649 3:46012695-46012717 TTCTTTCCTTTTTTTTGGTGGGG + Intergenic
954017077 3:47702914-47702936 TCTTTTCTTTTGTTTTGGTGGGG + Intronic
956319810 3:67984366-67984388 GCCATTCTTTTGATTTGGCAAGG + Intergenic
956748527 3:72328664-72328686 GCCTTTGCTTTGCTTTGCTTTGG - Intergenic
959374356 3:105570017-105570039 CCCTTTCCTTTGTTAGGCTAAGG - Intronic
959662442 3:108883981-108884003 GCCTTTCCTTGTTTTTGCAAAGG - Intergenic
960120707 3:113946892-113946914 GGGTTTGTTTTGTTTTGGTAAGG + Exonic
960136406 3:114110139-114110161 GCCTTTCCTTTCTCTTTGTTTGG + Intergenic
960264536 3:115605340-115605362 GCCTTCCCTTTCTTTTTGTCAGG - Intergenic
960928017 3:122815509-122815531 TCCCTTTCTTTGTTTTGGTATGG - Intronic
961432709 3:126894403-126894425 GTCTGTCCTTTGTCTTGGAAAGG - Intronic
961699975 3:128735845-128735867 GCCTTTTTTTCTTTTTGGTAAGG - Intronic
962245951 3:133793163-133793185 TCCCTTCCTTTTTTTTGGTGGGG - Intronic
963382350 3:144547549-144547571 GCCTTTCTTTTGTTTTCTTTTGG - Intergenic
963619233 3:147584148-147584170 GGCTTTCCTTTGATTGGGGATGG + Intergenic
963735960 3:149018084-149018106 GCCCTTACTTCATTTTGGTATGG + Intronic
963854664 3:150241249-150241271 TCTTTTCCTTTTTTTTGGTGGGG + Intergenic
964011625 3:151898842-151898864 GCCTTTCATTTGTTTTACAAAGG - Intergenic
964655111 3:159057934-159057956 GACTTTTATTTGTTTTGGGAGGG + Intronic
965312713 3:167150804-167150826 CCCTTTCCTTTGCTTTGGCAAGG - Intergenic
965487488 3:169295780-169295802 GTCTTTGCTTTGTTTTGTTTTGG - Intronic
966092061 3:176151513-176151535 CCCTTTCTTTTGTTTTAGTAGGG - Intergenic
968377894 4:59192-59214 TGCTTTGCTTGGTTTTGGTAGGG + Intronic
969685058 4:8666875-8666897 ACCTTTCCTTTTTTTTGGAGTGG - Intergenic
971699480 4:29951797-29951819 GCCTTTCCTTTTTGTCAGTAAGG - Intergenic
971737574 4:30475403-30475425 GCATTTCTTTTGTTTTGGTTTGG - Intergenic
973041532 4:45475580-45475602 GCCTTTCCTTTGTAGGGGCAAGG + Intergenic
975679495 4:76861997-76862019 GCGTTTCCTTTGGTGTAGTATGG - Intergenic
976551548 4:86402214-86402236 TGCTTTCCTTTGTGTTGGTTTGG - Intronic
976799844 4:88976824-88976846 ACCTTTTCTTTGTTTAGATATGG + Intronic
977793747 4:101137561-101137583 GCCTTTGGTTTGGTTGGGTAGGG - Intronic
981479253 4:145220219-145220241 GCCTTTCTTATGTTCAGGTATGG - Intergenic
981746687 4:148058958-148058980 GCATTTCCTGTGTTTAGGTGGGG - Intronic
982014866 4:151143364-151143386 TCATTTTCTCTGTTTTGGTACGG - Intronic
982772745 4:159413044-159413066 GCCTTTTCTTTGCTATGGTCAGG + Intergenic
982885464 4:160774726-160774748 GTTTTTCCTTTGTTTAGGTAGGG + Intergenic
985447143 4:190029510-190029532 GCTTTTTGTTTGTTTTGGTTTGG - Intergenic
986008417 5:3687702-3687724 GATTTTGTTTTGTTTTGGTATGG + Intergenic
986576971 5:9222353-9222375 ACCTCTCCTGTGTTTTGTTAGGG - Intronic
987191487 5:15483122-15483144 GCCTTTCATTAGTTTTGCAAAGG + Intergenic
987294459 5:16537695-16537717 TCCTTTGCTTTGTTTTGGGTGGG - Intronic
987456879 5:18158175-18158197 CACTTTGCTCTGTTTTGGTAAGG - Intergenic
987486112 5:18529205-18529227 TTCTTTGCTTTGTTTTGGTTTGG - Intergenic
990191517 5:53265098-53265120 GCCTTTGCTTAGTTTTACTAAGG - Intergenic
990493220 5:56321783-56321805 GCCTTTCTTGTGCTTGGGTATGG + Intergenic
991038426 5:62151566-62151588 TTCTTTCCTTATTTTTGGTAGGG - Intergenic
992007533 5:72492586-72492608 GCTTTTGCTTTGTTTTTGTGAGG - Intronic
992461613 5:76966020-76966042 TCCTTTCTTTTGTTTTGAGATGG + Intronic
992572617 5:78075413-78075435 GCCTTTCCTTTGTTTTGGTATGG - Intronic
992868015 5:80977189-80977211 GCCTGTCCTTTGTTATAGCACGG + Intronic
992957764 5:81927890-81927912 GCCTTTCCTTTGTGCTTGCATGG + Intergenic
997712592 5:136018293-136018315 GCCTTTCCTTGGTCTTGGACAGG - Intergenic
997961246 5:138323461-138323483 GCCATTTCTTTTTTTTGGTTGGG + Intronic
999886144 5:155925250-155925272 TCCTTTCATTTCTTTTGGTTCGG + Intronic
1000820492 5:165977052-165977074 GCTTCTCCTTTGTTCTTGTAAGG + Intergenic
1000940950 5:167359163-167359185 GCCATTGCATTGTTTTGGGAGGG - Intronic
1001417888 5:171560678-171560700 GCTTTTCTTTTGTTTTGAGACGG + Intergenic
1003355616 6:5366792-5366814 GCTTTTCTTGTGTTTTGGCAAGG + Intronic
1004319030 6:14618134-14618156 GCTTTTCCTTGCTTTTGGTTGGG - Intergenic
1004560560 6:16745578-16745600 GGCTTTCCTTTATTATTGTAAGG + Intronic
1005118964 6:22369590-22369612 GCCTTCCCTCTGTTTTTATATGG + Intergenic
1007098104 6:39226956-39226978 CCCATTACTTTTTTTTGGTAGGG + Intronic
1010308829 6:74358424-74358446 ACCTTTCCTTTCTTGTGATACGG - Intergenic
1011004154 6:82625001-82625023 GTTTTTCTTTTGTTTTGGTTAGG + Intergenic
1014986629 6:128019386-128019408 GCTTTTCCTTTCTTTTTGTTAGG - Intronic
1015618826 6:135108020-135108042 TCATTTCCTTTTTTTTGGGAGGG + Intergenic
1016103497 6:140132328-140132350 GCCTTTACTATTTTTAGGTATGG - Intergenic
1016821069 6:148347026-148347048 GGCATTCCTTTTTTTAGGTAGGG + Intronic
1017253071 6:152302473-152302495 GCCTTGCATTTTTTTTGGTGTGG - Intronic
1017510742 6:155112543-155112565 GTCTTTCCTTTGTTTACTTATGG + Intronic
1018597420 6:165497128-165497150 GATTTTCCTTTTTTTTGATATGG - Intronic
1018843271 6:167533928-167533950 GCCTTTTCTATGTTTGGGTCTGG - Intergenic
1019000039 6:168742375-168742397 GACTTTCTTTTGTTTGGGCATGG - Intergenic
1020260721 7:6529444-6529466 GCCTTTTCTTTTTTTTGAGATGG - Intronic
1020410120 7:7882939-7882961 CCCTTTCTTTTTTTTTGGCAGGG - Intronic
1021123213 7:16820581-16820603 GGCTTTGTTTTGTTTTGGTACGG + Intronic
1021413614 7:20356200-20356222 TCCTTCCCTTTATTTTTGTAGGG + Intronic
1021606072 7:22410881-22410903 GCCTTTCCTTCCTCTTGGAATGG - Intergenic
1022381952 7:29868839-29868861 ACCTTTCCTATGTTTAGATATGG - Intronic
1023311476 7:38891382-38891404 GCTTTTCCTTTGTTTATATATGG + Intronic
1024293505 7:47824630-47824652 GCCTTTCCCTTGTTTTATTTAGG + Intronic
1024667575 7:51562119-51562141 TCCTGTCCATTGGTTTGGTATGG - Intergenic
1025087061 7:56031893-56031915 GCCTTTTCTTGGTTTTGTTTTGG - Intronic
1025952671 7:66157840-66157862 GCTTTTGCTTTGTTTTTTTAAGG + Intergenic
1025953983 7:66168633-66168655 GCCTTTTTTTTTTTTTGGTGGGG + Intergenic
1026494472 7:70890537-70890559 GACTTTCCTGTCTTTGGGTAGGG + Intergenic
1026655735 7:72255088-72255110 GCCTTTCTTTTCTTTTGAGACGG + Intronic
1027705979 7:81534248-81534270 GAATTTCCTTTGTTATGGTCTGG + Intergenic
1028492522 7:91428018-91428040 AACTTTCCTTTGTTTGTGTAAGG - Intergenic
1028698999 7:93754223-93754245 GCCTTTCATTTGTTTTCCGAAGG - Intronic
1028757604 7:94455926-94455948 TCTTCTCCTTTGGTTTGGTAGGG - Intergenic
1028937543 7:96483061-96483083 CCATTTCCTTTGTGTTAGTAAGG + Intronic
1030031333 7:105372543-105372565 TTCTTTCCTTTGTTTGGGTTGGG - Intronic
1031203169 7:118717817-118717839 GCCTTTCCTTTGCTCTCCTACGG - Intergenic
1032141890 7:129339021-129339043 TCCTTTCCTTTTATTTGGAAAGG + Intronic
1035869249 8:3119180-3119202 GCATTTCCTTTTTTTTGGGGCGG - Intronic
1036532892 8:9612500-9612522 GCCTATCTCTTGTTTTCGTATGG + Intronic
1038422327 8:27441341-27441363 GCCTTTCATCTATTTTTGTATGG - Intronic
1038478847 8:27887543-27887565 GCCTCTCCTTGTTTTTAGTAAGG - Intronic
1039250156 8:35654735-35654757 GCTTTTTCTTTCTTTTGGGAGGG + Intronic
1039566738 8:38557398-38557420 GGTTTTCCTTTGCTTGGGTATGG + Intergenic
1040422578 8:47253856-47253878 GGGTTGCCTTTGTTTTGGTTGGG - Intergenic
1041993146 8:64018817-64018839 GCTCTTGGTTTGTTTTGGTATGG - Intergenic
1043345006 8:79288225-79288247 GCCTTTTCTTTGGTTTCATATGG - Intergenic
1044243442 8:89913200-89913222 GCCTTTCATTAGTTTTAGAAAGG + Intronic
1047373239 8:124273483-124273505 GCTTTTTTTTTGTTTTGGTTTGG + Intergenic
1047945216 8:129870024-129870046 ACCCTTCCTTTGTTTTTGTCTGG - Intronic
1048557226 8:135491400-135491422 TTCTTTCCTTTTTTTTGGTGTGG - Intronic
1051170133 9:14313413-14313435 GCCTTTGTTTTGTTTTGTTGCGG - Intronic
1051312806 9:15794475-15794497 GACTTTTCTTTTTTTTGGTGGGG - Intronic
1051945384 9:22563300-22563322 GCATTTCCTTCGTTTTTTTAAGG - Intergenic
1055191212 9:73527191-73527213 GCCTTTCATTAGTTTTGCAAAGG - Intergenic
1055715810 9:79116836-79116858 TCCTTTCTTCTGTTTTGGTTTGG - Intergenic
1055967340 9:81878428-81878450 TGCTTTGCTTTGTTTTGGTTTGG + Intergenic
1056846486 9:90042053-90042075 TCCTTGCCTTTGTTTTGTTTGGG - Intergenic
1057140548 9:92724352-92724374 TTTTTTCCTTTGTTTTGGGAGGG - Intronic
1058445412 9:105050606-105050628 GCCTTTCCTTTGGGTTGGCGTGG + Intergenic
1058487960 9:105461351-105461373 GTTTTTCTTTTTTTTTGGTACGG - Intronic
1058881424 9:109288890-109288912 TCCTTTCCTTTTTTTTGACAAGG - Intronic
1058897886 9:109415819-109415841 GCTGTTCCTGTGTCTTGGTAAGG - Intronic
1059516118 9:114897270-114897292 TTTTTTCTTTTGTTTTGGTATGG + Intronic
1059746404 9:117205958-117205980 CCATTTCCTTTGTTTTGTTTGGG - Intronic
1060769616 9:126322599-126322621 TACTTTCCATTGTTTGGGTAGGG + Intergenic
1203571344 Un_KI270744v1:135055-135077 TGCTTTGCTTGGTTTTGGTAGGG - Intergenic
1186215249 X:7293053-7293075 GGCTTGCCTCTGTTTTGGGAGGG + Intronic
1186832444 X:13404204-13404226 GGCTTTCCTTGGCTTGGGTAGGG - Intergenic
1186862839 X:13689965-13689987 GCTTTTTTTTTTTTTTGGTAAGG + Intronic
1186909202 X:14143591-14143613 TCCTTTCCCTTATTTTGTTATGG + Intergenic
1186983073 X:14979110-14979132 GCCATTCTATTGTTTTGGCATGG + Intergenic
1188900105 X:35721766-35721788 GCCTTTCATTTGATTTGGCAAGG - Intergenic
1190850421 X:54234849-54234871 GCTTTTGTTTTGTTTTGGTTTGG - Intronic
1190897389 X:54634303-54634325 TCCTTTCCTTTTTTTTGAGATGG + Intergenic
1193508608 X:82372466-82372488 CCTTTTCCTTTTTTATGGTATGG + Intergenic
1193805945 X:85994558-85994580 ACCCTTCCTTTGTCTTGGAAGGG + Intronic
1197005819 X:121496012-121496034 GCATTTCATATGATTTGGTATGG + Intergenic
1197872729 X:131074614-131074636 TCCTTTCCTTTGTTCTTTTAAGG - Intronic
1198073211 X:133169939-133169961 GCCTTTCCTTAGCTTTGCAAAGG - Intergenic
1199442042 X:147879325-147879347 GCATTTCCTTTTTTTTTTTAAGG + Intergenic
1201101511 Y:10678843-10678865 TCCTTTCCTTTCTTTTGATAGGG + Intergenic
1201889756 Y:18929213-18929235 GCATTTCATTTGTGTTGGGAAGG + Intergenic
1202623085 Y:56832383-56832405 TCCATTCCTTTGTTTTGACAGGG + Intergenic