ID: 992576067

View in Genome Browser
Species Human (GRCh38)
Location 5:78114093-78114115
Sequence TTCCTTTAGCACTGTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992576066_992576067 -2 Left 992576066 5:78114072-78114094 CCATTCTTTCAGCTCTATGGATT 0: 1
1: 1
2: 2
3: 20
4: 267
Right 992576067 5:78114093-78114115 TTCCTTTAGCACTGTGAGCTTGG 0: 1
1: 0
2: 1
3: 29
4: 219
992576061_992576067 6 Left 992576061 5:78114064-78114086 CCCACACCCCATTCTTTCAGCTC 0: 1
1: 0
2: 2
3: 26
4: 265
Right 992576067 5:78114093-78114115 TTCCTTTAGCACTGTGAGCTTGG 0: 1
1: 0
2: 1
3: 29
4: 219
992576062_992576067 5 Left 992576062 5:78114065-78114087 CCACACCCCATTCTTTCAGCTCT 0: 1
1: 0
2: 2
3: 60
4: 460
Right 992576067 5:78114093-78114115 TTCCTTTAGCACTGTGAGCTTGG 0: 1
1: 0
2: 1
3: 29
4: 219
992576060_992576067 27 Left 992576060 5:78114043-78114065 CCACTTGTTTAACATTTTATTCC 0: 1
1: 0
2: 0
3: 42
4: 398
Right 992576067 5:78114093-78114115 TTCCTTTAGCACTGTGAGCTTGG 0: 1
1: 0
2: 1
3: 29
4: 219
992576064_992576067 0 Left 992576064 5:78114070-78114092 CCCCATTCTTTCAGCTCTATGGA 0: 1
1: 0
2: 0
3: 22
4: 196
Right 992576067 5:78114093-78114115 TTCCTTTAGCACTGTGAGCTTGG 0: 1
1: 0
2: 1
3: 29
4: 219
992576065_992576067 -1 Left 992576065 5:78114071-78114093 CCCATTCTTTCAGCTCTATGGAT 0: 1
1: 0
2: 0
3: 14
4: 197
Right 992576067 5:78114093-78114115 TTCCTTTAGCACTGTGAGCTTGG 0: 1
1: 0
2: 1
3: 29
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992576067 Original CRISPR TTCCTTTAGCACTGTGAGCT TGG Intronic
902103294 1:14011672-14011694 TTCCATGAGCTCTGTGACCTTGG + Intergenic
905223845 1:36466765-36466787 CTCCTCCAGCACTGTGAGCTTGG + Exonic
908009909 1:59765326-59765348 CTCCTACAGCACTGTGAGGTAGG + Intronic
908030520 1:59994384-59994406 TTATTTTATCACTTTGAGCTTGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911504559 1:98732605-98732627 TTCCTTTAGCATAGTGAATTGGG + Intronic
913645384 1:120849718-120849740 TGTCTTTTGCACTGAGAGCTGGG - Intergenic
914081346 1:144413820-144413842 TGTCTTTTGCACTGAGAGCTGGG + Intergenic
914176253 1:145282359-145282381 TGTCTTTTGCACTGAGAGCTGGG + Intergenic
914378418 1:147093940-147093962 TTCTTTTAGCATAGTGAGTTTGG + Intergenic
914530980 1:148523845-148523867 TGTCTTTTGCACTGAGAGCTGGG + Intergenic
916544544 1:165790524-165790546 TTCCTTTAGAACTGGGAGAAGGG + Intronic
918798724 1:188941911-188941933 TTCCTTTAGCTTTGTGAGTTGGG - Intergenic
919151216 1:193701316-193701338 TCCCTTTATCACTGTAACCTTGG - Intergenic
920950790 1:210570165-210570187 TTACCTTAGCACTGTGAGAAGGG + Intronic
921742785 1:218705726-218705748 ATTCATTAGCACTGGGAGCTTGG + Intergenic
922226127 1:223647258-223647280 TTCCTTTAGCATAATGAGTTTGG - Intronic
922478390 1:225922399-225922421 CTGCTCCAGCACTGTGAGCTGGG - Intronic
1062906953 10:1185844-1185866 ACCCTTCTGCACTGTGAGCTGGG - Intronic
1064068463 10:12204146-12204168 TTAATTAATCACTGTGAGCTGGG + Intronic
1065113357 10:22461222-22461244 TTCCTTTAGCTATGTGACCTAGG - Intergenic
1065641174 10:27783723-27783745 TTCCTTGAGGACTGTTGGCTGGG + Intergenic
1065939743 10:30553486-30553508 TCCCTTTGGCATTGTGAGTTTGG - Intergenic
1066364624 10:34764857-34764879 TACTTTGAGCACTGTGTGCTGGG - Intronic
1067383094 10:45793419-45793441 TTCCTTGGGCACTGTAAGATCGG + Intergenic
1067890802 10:50133967-50133989 TTCCTTGGGCACTGTAAGATCGG + Intergenic
1068680925 10:59818903-59818925 TTGCTTTTGAACTGTGAGTTGGG + Intronic
1069324986 10:67222353-67222375 TGTCATTAGCACTGTGAGCTAGG + Intronic
1071010072 10:80928020-80928042 TTCCTTTAGCTTGGTCAGCTAGG - Intergenic
1074753046 10:116605517-116605539 TCCCTTTTGCACAGTGATCTTGG - Exonic
1074781648 10:116806682-116806704 GCCCCTTAGCACTGTGAGCCAGG - Intergenic
1075757823 10:124829265-124829287 TTCCTTAAACACTGTCACCTCGG + Intronic
1077291011 11:1793300-1793322 TTCCTTTGGCACTGATTGCTGGG + Intergenic
1078144349 11:8712860-8712882 GTCCTCCTGCACTGTGAGCTGGG - Intronic
1078200465 11:9177942-9177964 ATCCTTTAACACTGTTAGTTAGG - Intronic
1078441722 11:11373669-11373691 TTCCTTGAGGGCTGTGAGCTTGG + Intronic
1079788542 11:24706929-24706951 TTTCTATAGCACTGTGATCTGGG + Intronic
1080876206 11:36276672-36276694 TCCCTTCAGCCCTGTGAGCTAGG - Intronic
1080993499 11:37571267-37571289 ATCCTATACCACTGTGAGATGGG + Intergenic
1081274397 11:41129876-41129898 TTCCTTTACTTCTGTGAGGTTGG + Intronic
1082758248 11:57099721-57099743 TTCCTTTAGTCATGTGACCTTGG - Intergenic
1084709674 11:70836151-70836173 TCCCTTAAGGACTGAGAGCTGGG - Intronic
1085023074 11:73221266-73221288 TTCCTATAGCCCTGTGAGGGAGG + Intronic
1085132502 11:74053421-74053443 TTACTTTAGCAGTGTGACCTTGG - Intronic
1085842948 11:80034378-80034400 TTACATTCGCACTGTGAGGTAGG - Intergenic
1088185594 11:107164946-107164968 TCCCTTTAGGACTGGGAACTAGG - Intergenic
1090170165 11:124594877-124594899 CTCCATTAGCTCTGTGACCTTGG + Intergenic
1093155944 12:15685299-15685321 TTACACTAGCACTGTGAGCTCGG - Intronic
1093247164 12:16754000-16754022 TCCCTTTAGTACTGTTATCTTGG - Intergenic
1093529016 12:20138536-20138558 TTCACTTAGCTCTGTGATCTTGG - Intergenic
1094402063 12:30072740-30072762 TCCCTTTGGCACAGTGAGTTTGG - Intergenic
1095543897 12:43343085-43343107 TTCCCTCTGCACTTTGAGCTTGG + Intergenic
1097609193 12:61797251-61797273 TTCTTTTGGCACTGTGAGGTAGG - Intronic
1101484069 12:105133183-105133205 TACCTGAAGCACTGTGAGCAGGG - Intronic
1102156654 12:110735390-110735412 GTCCTTAAGCTCTGTGACCTTGG - Intronic
1106934579 13:34704113-34704135 TCCCTTTTGCAATGGGAGCTAGG + Intergenic
1107431713 13:40346166-40346188 TTCCTTTGGCACTGTGTGGATGG + Intergenic
1111815371 13:93146589-93146611 TTCCTTTAGCTCAGTGTGATGGG - Intergenic
1114082775 14:19216019-19216041 TCCCTTTGACACAGTGAGCTTGG + Intergenic
1116206648 14:41875774-41875796 TCCCTTTGGCATTGTGAGTTTGG - Intronic
1118084824 14:62402674-62402696 TTCATTTAGAAGTGTGACCTCGG + Intergenic
1118187821 14:63553608-63553630 TTCATTGAACACTATGAGCTAGG + Intergenic
1119972294 14:78984813-78984835 GGGCTGTAGCACTGTGAGCTAGG + Intronic
1120669914 14:87351347-87351369 ATCCTATAGCACTGTGAAATGGG - Intergenic
1121327155 14:93027862-93027884 TTCCTTGGGCACTGAGAGCAGGG - Intronic
1121849518 14:97207340-97207362 TTCCGTTAGCAGTTTGCGCTTGG - Intergenic
1122069353 14:99195597-99195619 TTGCTTTACCTCTCTGAGCTTGG - Intronic
1123819044 15:24008304-24008326 TTCCTTTGGCATAGTGAGTTTGG + Intergenic
1123832226 15:24152056-24152078 TTCCTTTGGCACAGTGAGTTTGG - Intergenic
1123866714 15:24526900-24526922 TTCCTTTGGCATAGTGAGTTTGG + Intergenic
1124261505 15:28196552-28196574 TTCCATTGGCACTGAAAGCTAGG + Exonic
1126594496 15:50371908-50371930 TTCCTTTAGGAGTGAAAGCTTGG + Intergenic
1127262379 15:57335710-57335732 TTCCTCCAGCAGTCTGAGCTGGG - Intergenic
1129973105 15:79797701-79797723 GACCTGTAGCACTGGGAGCTGGG + Intergenic
1130846206 15:87748572-87748594 TTCCTTTAGCATTGGGGGCCTGG + Intergenic
1131276145 15:90982994-90983016 TTCATTTAACATTGTGAACTAGG + Intronic
1144123600 17:12180338-12180360 TTCCTATAGCACTGGGGGCCTGG + Intergenic
1144967598 17:19087836-19087858 TTCCCTTATCACTGTGAACCCGG - Intergenic
1149470022 17:56908864-56908886 TCCCAATAGCCCTGTGAGCTGGG - Intronic
1150549885 17:66200185-66200207 TGCCTTTAGCACAGTGACTTTGG + Intergenic
1152090387 17:78243434-78243456 TTCCCATAGCACTGTGGGTTAGG - Intergenic
1153852443 18:9108420-9108442 TTTATTTAGCTGTGTGAGCTAGG + Intronic
1155139892 18:23035602-23035624 TTCCTGTAACACTGTGAGTACGG - Intergenic
1157114385 18:44849469-44849491 TTCCTTCAGCAGTATGAGCCCGG + Intronic
1157735527 18:50045367-50045389 TCCCTTTGGCACAGTGAGTTTGG + Intronic
1158214563 18:55086469-55086491 TTACTATAGCACTATGAACTAGG + Intergenic
1160030784 18:75257821-75257843 ATCCCCTAGCTCTGTGAGCTTGG + Intronic
1160599739 18:80003447-80003469 TTCCTTTGGAATTGTGAGTTTGG + Intronic
1160920701 19:1518924-1518946 TGGCTTTAGCACTGGCAGCTGGG - Intergenic
1166512703 19:43420422-43420444 TCCCTTTAGCATAGTGAGTTTGG - Intergenic
1167774060 19:51543277-51543299 TTCCTCCAGCACTGGGACCTGGG + Intergenic
926226092 2:10967874-10967896 TTCCTTTAGCTGAGTGACCTTGG - Intergenic
926845990 2:17139681-17139703 TTCCTTTGGCATAGTGAGTTTGG + Intergenic
927631595 2:24779041-24779063 TCCCTTTAGCACAGTGAGTTTGG + Intergenic
928777744 2:34787349-34787371 TTCCTTTACAACTGGGAGCTGGG + Intergenic
930690717 2:54360920-54360942 TTCCTTGAGCTGTGTGACCTTGG + Exonic
931600919 2:64001793-64001815 ATCTTTTAGAGCTGTGAGCTGGG + Intronic
932940099 2:76154162-76154184 TTCCTTTCGCACTATTAGGTCGG + Intergenic
933686472 2:85145621-85145643 GTCCTCTAGCCCTCTGAGCTAGG + Intronic
938493803 2:131780599-131780621 TCCCTTTGACACAGTGAGCTTGG - Intergenic
940200907 2:151149615-151149637 TCCCATTAGCACTGTGGGCGTGG - Intergenic
943324483 2:186481479-186481501 TTCCAATAGCCCTATGAGCTAGG + Intergenic
944108785 2:196108545-196108567 ATCTTTTAGCTCTGTGACCTAGG + Intergenic
945805538 2:214485574-214485596 TTCCTTTTTCCCTGTGTGCTGGG - Intronic
946596408 2:221310363-221310385 TTCCCTTAGAGCTGTGGGCTTGG - Intergenic
948631272 2:239304186-239304208 TGCCTCAAGCAGTGTGAGCTCGG + Intronic
1171967863 20:31543960-31543982 TCCCTTTATCACTGTGACCTGGG + Intronic
1173154611 20:40597008-40597030 TTCATTTAACCCTGTGTGCTGGG - Intergenic
1175537916 20:59728236-59728258 TTCGTTTAGCACCATGATCTTGG + Intronic
1176711082 21:10150111-10150133 TCCCTTTGACACAGTGAGCTTGG - Intergenic
1177510192 21:22076364-22076386 TTCTGCTAGCACTGTCAGCTAGG + Intergenic
1180498004 22:15906650-15906672 TCCCTTTGACACAGTGAGCTTGG - Intergenic
1181808260 22:25388201-25388223 TTCCAGTTGCCCTGTGAGCTGGG - Intronic
1181891591 22:26068319-26068341 TTCCTAAAATACTGTGAGCTTGG + Intergenic
1182312090 22:29416439-29416461 TTTCTTTAGGACGGTCAGCTGGG - Intronic
1182688170 22:32136804-32136826 TTTCTTTAGGACGGTCAGCTGGG + Intergenic
1183450541 22:37892319-37892341 ATCCTTTAGCTCTGGGAACTTGG - Intergenic
1183839053 22:40482580-40482602 TTCCTTTAGCACTTTTAGGTAGG + Intronic
1184606917 22:45579556-45579578 TGCCTGTAGCCCTGTGTGCTGGG + Intronic
949742628 3:7253737-7253759 ATACCCTAGCACTGTGAGCTTGG - Intronic
950134350 3:10570234-10570256 TTCCAAGAGCACTCTGAGCTGGG + Intronic
950212028 3:11130765-11130787 TTGCAATAGCACTGTGAGCTGGG + Intergenic
950549797 3:13659212-13659234 TTCCTTTCTCTCTGTGTGCTTGG + Intergenic
950796266 3:15512870-15512892 TTCCCTTAGCTTTGTGACCTTGG - Intronic
954534959 3:51352952-51352974 TTACTTTAGCTCTATCAGCTTGG + Intronic
955094473 3:55783347-55783369 TTACCTTAGCCCTGTGATCTTGG - Intronic
955691392 3:61593926-61593948 TTCCTTAATCACTTAGAGCTTGG + Intronic
957383681 3:79467776-79467798 TTCCTTTAGCCCTGCCAGCCAGG - Intronic
958687185 3:97413690-97413712 TCCCTTTGGCACGGTGAGTTTGG + Intronic
958752749 3:98211872-98211894 TTCATGAAGCCCTGTGAGCTTGG - Intergenic
960196591 3:114776111-114776133 TTCCGCTAGCACTGTCAGCCAGG - Intronic
960225913 3:115168406-115168428 ATCTTTTAGCACTTAGAGCTTGG + Intergenic
962172391 3:133115551-133115573 TTCTATTAGCAGTGTAAGCTTGG - Intronic
962550974 3:136491377-136491399 TCCCTTTATTACTGTGATCTGGG + Intronic
963893011 3:150656979-150657001 TTCCTTTGGCATAGTGAGTTTGG + Intergenic
963941488 3:151100055-151100077 TTCCTTTATCAGTCTGAGCGAGG + Intronic
965092444 3:164180654-164180676 TTCTTATAGCATTGTGAGATTGG - Intergenic
965249871 3:166329112-166329134 TTCTTTTAGCAATGTGAGAATGG - Intergenic
966853783 3:184180474-184180496 TTCCTTTTGCACTGAGGGGTGGG + Intronic
967197540 3:187041673-187041695 TTTCCTCAGCTCTGTGAGCTTGG + Intronic
967838354 3:193983047-193983069 TTCTTGTAACTCTGTGAGCTAGG - Intergenic
968680584 4:1916131-1916153 TCACTCTAGCACTGTGAGATAGG + Intronic
968761615 4:2445211-2445233 TTCCTTGGGCTCTGTGACCTTGG - Exonic
970316085 4:14829579-14829601 TTCCTTCACACCTGTGAGCTGGG + Intergenic
970318966 4:14856747-14856769 TTCCTTTCAGACTTTGAGCTGGG + Intergenic
971665633 4:29479967-29479989 TTCCTATAGCAATGTGAGAATGG + Intergenic
973006289 4:45010728-45010750 TTCCTTTGTCATAGTGAGCTTGG - Intergenic
974088666 4:57287877-57287899 TTCCTTTAGTCCTTTGATCTGGG - Intergenic
974295788 4:59997395-59997417 ATCCTTTAGCTCTCTAAGCTTGG + Intergenic
976238209 4:82923748-82923770 TTCCTTTAAGACTGGGAGCAAGG - Intronic
976825409 4:89255203-89255225 TAGCTTTAGCTCTGTGTGCTTGG + Intronic
981473804 4:145167157-145167179 TTCCTATAGTACTGTGAAGTCGG + Intronic
982382069 4:154759950-154759972 TAACTGTAGCACTGTGATCTTGG - Intergenic
983427423 4:167604279-167604301 TTCTTTTATCACTTTGAGATAGG + Intergenic
986003558 5:3649164-3649186 GTCCTGTAGCCCTGTGAGTTTGG + Intergenic
986763480 5:10901249-10901271 TTCCTTTGGCATAGTGAGTTTGG - Intergenic
987488627 5:18550567-18550589 TTCCTTTAGCTTAGTGAGTTTGG - Intergenic
987495091 5:18632789-18632811 TTTCTTTGGCACAGTGAGTTTGG - Intergenic
992007752 5:72495155-72495177 ATTCTTTACCACTGTGAACTGGG - Intronic
992453339 5:76893092-76893114 TCCCTTTGGCACAGTGAGTTTGG + Intronic
992576067 5:78114093-78114115 TTCCTTTAGCACTGTGAGCTTGG + Intronic
992895379 5:81240679-81240701 TCCCTTTAGCTGTGTGACCTTGG + Intronic
993089246 5:83403444-83403466 TTTCTTTACCTCTCTGAGCTTGG + Intergenic
993811123 5:92477386-92477408 CTCCTTAAGCAGTGTGACCTTGG - Intergenic
995087740 5:108134579-108134601 TTCCTTTGGTACACTGAGCTGGG - Intronic
996884048 5:128334754-128334776 TTCATTTGCCACTGTCAGCTGGG - Exonic
996898814 5:128520126-128520148 CTCCTTTAGCCTTGTGACCTGGG + Intronic
997347819 5:133204952-133204974 TACCTTCATCACTGTGGGCTAGG - Intronic
999693382 5:154167915-154167937 TTCCTTTGGCATTGTGAGTTTGG + Intronic
1000199657 5:158995622-158995644 TTTGTTAAGCTCTGTGAGCTTGG + Intronic
1001220917 5:169900136-169900158 CTCCTTTAGATCTGAGAGCTTGG - Intronic
1002658531 5:180773185-180773207 TTCCTTTAGCTCCGTGATTTTGG - Intergenic
1004079079 6:12373069-12373091 TTCCTATAGCACTGTGATTGAGG + Intergenic
1005559434 6:27023074-27023096 TCCCTTCTGCAATGTGAGCTTGG + Intergenic
1005921489 6:30405834-30405856 TCCCTTTGGCACTGTGAGTTTGG - Intergenic
1006129263 6:31859541-31859563 TTCCTTTAGGACTGAAAGCTAGG - Exonic
1006973831 6:38077273-38077295 TACCTTTAGAACTGTGAGCCTGG + Intronic
1007725251 6:43912132-43912154 TTCATTTAGTCCTGTGAGCTGGG + Intergenic
1008669977 6:53757675-53757697 ATCCTGTAGCACTGTGAGTGAGG + Intergenic
1011213534 6:84980321-84980343 ATGCTTTAGCTGTGTGAGCTTGG + Intergenic
1012521955 6:100132093-100132115 TTTCTTTAGCACTCTGAGTGAGG + Intergenic
1012846652 6:104397733-104397755 TGCAATTAGCACTGTGAGCTTGG - Intergenic
1014071825 6:117190838-117190860 TTACATTAGCACTGCTAGCTGGG + Intergenic
1014277824 6:119406278-119406300 TCCCTTTGGCATAGTGAGCTTGG - Intergenic
1015220140 6:130795002-130795024 TTCCTTCAGGCCTGTGGGCTGGG + Intergenic
1015286542 6:131491714-131491736 TCCCTTTAGCATAGTGAGTTTGG + Intergenic
1015373477 6:132482768-132482790 TTCCTTGATCACTTTCAGCTGGG - Intronic
1016511450 6:144847829-144847851 TCCCTTTAGCATAGTGAGTTAGG + Intronic
1017269416 6:152489429-152489451 ATGCATTAGCTCTGTGAGCTTGG + Intronic
1017587313 6:155941118-155941140 TTCTTTTAGCAATGTGAGAATGG + Intergenic
1021295011 7:18893934-18893956 TTCCTTTGGCACTGTGGGCTTGG - Intronic
1022179791 7:27907887-27907909 TTTCTTCAGCACTGTGCCCTAGG + Intronic
1022345759 7:29512773-29512795 TTCCTTTAGCTGTGTCAACTTGG - Exonic
1023558107 7:41444371-41444393 TGCCTTTAGCAGTTTGAGATGGG + Intergenic
1024823177 7:53358332-53358354 TTACTTTAACTCTGTGATCTTGG - Intergenic
1025888835 7:65625647-65625669 TTACGTTAGCACTATGAGGTAGG + Intergenic
1026143948 7:67729481-67729503 TCCCTTTGGCATAGTGAGCTTGG + Intergenic
1026502614 7:70955922-70955944 TCTCTTTAGCACAGTGAGCTTGG - Intergenic
1027730462 7:81865105-81865127 TTCCTTTTCAACTGTGATCTTGG + Intergenic
1027795290 7:82685407-82685429 TTCATTAAGCACTATGACCTGGG + Intergenic
1028944722 7:96564438-96564460 ATCCTTTTGCAATGAGAGCTGGG - Intronic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1031010270 7:116519244-116519266 TTCCTCTAGCAATTTTAGCTAGG + Intergenic
1031901671 7:127418003-127418025 CTCCTTTAGCAGTGTCATCTTGG - Intronic
1031974238 7:128083964-128083986 TTCCCTAAGCACTCTGACCTTGG - Intronic
1036048093 8:5166421-5166443 TCCCTTTAGCATAGTGAGTTTGG + Intergenic
1036719819 8:11163825-11163847 TTCATTTAGCCCTGTGACCTAGG - Intronic
1037737397 8:21578633-21578655 GTCCTTCAGCCCTGTCAGCTGGG - Intergenic
1038239533 8:25795999-25796021 TTCCTATAACACTTTGAGGTAGG + Intergenic
1038417154 8:27405370-27405392 TACCTCTTGCACTGTGACCTTGG - Intronic
1040524423 8:48207025-48207047 TTCCTTTAGCATTTTGGGCTCGG - Intergenic
1041320756 8:56610225-56610247 TTCCTTTGGCAGAGTGAACTGGG - Intergenic
1041544493 8:59026543-59026565 TTCCTTTAGCAATCTGAATTTGG + Intronic
1043271458 8:78339341-78339363 TTCATTTGGAACTGGGAGCTGGG - Intergenic
1043507515 8:80916972-80916994 TTCCTTTCACACTGTGATTTGGG + Intergenic
1044527878 8:93272353-93272375 TTCCATTATCACTTTGACCTTGG + Intergenic
1045571751 8:103374867-103374889 TTACATTAGCTCTGTGAGATAGG - Intronic
1046396297 8:113644652-113644674 TCCCTTTGGCAGTGTGAGCAGGG + Intergenic
1047136041 8:122079479-122079501 TTCATTTTTCACTGTGACCTAGG + Intergenic
1051273546 9:15377662-15377684 TTCCTTTGGCATAGTGAGTTTGG - Intergenic
1053648078 9:40135806-40135828 TCCCTTTGACACAGTGAGCTTGG - Intergenic
1053757660 9:41328039-41328061 TCCCTTTGACACAGTGAGCTTGG + Intergenic
1054329049 9:63733751-63733773 TCCCTTTGACACAGTGAGCTTGG - Intergenic
1054536502 9:66240365-66240387 TCCCTTTGACACAGTGAGCTTGG + Intergenic
1054888933 9:70230940-70230962 TTCCTTCAGCACAGGGAGATTGG + Intergenic
1055484466 9:76744264-76744286 TCCCTTTATCACTTTGAACTTGG - Intronic
1055493282 9:76827844-76827866 TTAGTATAACACTGTGAGCTGGG - Intronic
1056850630 9:90080828-90080850 TCCTTTTGGCACTGTGAACTGGG - Intergenic
1056939530 9:90943091-90943113 GTCTTTGAGCACTGTGACCTTGG - Intergenic
1057586165 9:96330695-96330717 TCCCTTTGGCATTGTGAGTTTGG - Intronic
1057736135 9:97662975-97662997 TTCCTTCATCACTTTCAGCTAGG - Exonic
1058040558 9:100297117-100297139 TTGCTTAAGCACTGAGTGCTTGG - Exonic
1059114096 9:111585352-111585374 TTCCCTCTGCACTGTGAGCCAGG - Intronic
1059315339 9:113420590-113420612 TTCCTTGAGCACTATGTTCTAGG + Intronic
1060002340 9:119969803-119969825 TTCCTGCACCACTGTGAGCCTGG - Intergenic
1060894158 9:127207011-127207033 TTCATATAACACTGTGAGGTAGG - Intronic
1062510813 9:136904910-136904932 TTCCTTTAGCAGGCTTAGCTTGG + Intronic
1062675307 9:137739758-137739780 TGCCTTTTGCTTTGTGAGCTTGG + Intronic
1202795838 9_KI270719v1_random:119100-119122 TCCCTTTGACACAGTGAGCTTGG - Intergenic
1185804915 X:3048179-3048201 TTCCTTTCACACTATGACCTCGG - Intronic
1189746153 X:44170986-44171008 ACACTTTCGCACTGTGAGCTAGG - Intronic
1189804550 X:44722281-44722303 TTCCTGTATCACTGTGACATGGG + Intergenic
1190502138 X:51089794-51089816 TTACTTTAGCTGTGTGAGCAAGG + Intergenic
1193138195 X:77996569-77996591 ATCCTTTAGCTCTGTGAGTGTGG - Intronic
1195338420 X:103879599-103879621 TCCTTTTTGCACTGTGAGCCTGG - Intergenic
1195759399 X:108229733-108229755 TTCCTTTATCACTATGACTTAGG + Intronic
1196912617 X:120499469-120499491 TTCACTTAGCACTGTGAACTTGG - Intergenic
1196996135 X:121386457-121386479 TTTCTTTAGCATTGTGACCAGGG + Intergenic
1200971159 Y:9153875-9153897 TTCTTTTTGGACTGTGAGCTGGG + Intergenic
1202139864 Y:21710422-21710444 TTCTTTTTGGACTGTGAGCTGGG - Intergenic