ID: 992581414

View in Genome Browser
Species Human (GRCh38)
Location 5:78182183-78182205
Sequence AAACCTAGAATCAGCTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992581414_992581415 21 Left 992581414 5:78182183-78182205 CCAGAGGAGCTGATTCTAGGTTT 0: 1
1: 0
2: 0
3: 17
4: 183
Right 992581415 5:78182227-78182249 TGCCAATAAAATATGCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992581414 Original CRISPR AAACCTAGAATCAGCTCCTC TGG (reversed) Intronic
905495833 1:38385114-38385136 GAATTTAGAATCAGCACCTCTGG - Intergenic
906035099 1:42745891-42745913 AAATGGAGATTCAGCTCCTCTGG - Intergenic
908120080 1:60978126-60978148 AAATCTTGACTCAGCTCTTCGGG + Intronic
908868490 1:68579744-68579766 AAACCTAGAAAAAACTCTTCTGG + Intergenic
910774115 1:90857868-90857890 ACACATAGATTCATCTCCTCTGG - Intergenic
912698537 1:111859178-111859200 ACACATAGCATCAGCTCATCAGG - Intronic
915196770 1:154195380-154195402 AATGCTATAACCAGCTCCTCTGG - Intergenic
916453315 1:164942790-164942812 AAACCTAGAAAGAACTCTTCTGG - Intergenic
919523252 1:198615396-198615418 AATCCTATAATCATCTCCTCAGG + Intergenic
919589894 1:199488293-199488315 AAACTAAGAATCAGCTACTTTGG - Intergenic
921229603 1:213055690-213055712 AAATTTAGAATCAGCTTGTCTGG + Intronic
921952055 1:220940474-220940496 ATACCTTGAATCAGATCCACTGG - Intergenic
923828515 1:237526904-237526926 AAACCTAGAAAAAACTCTTCTGG - Intronic
924383197 1:243481971-243481993 GAACCTAGCACCAGCTCCACAGG - Intronic
924888588 1:248248173-248248195 ACACCTATAATCAGCTACTCAGG + Intergenic
1068270967 10:54723452-54723474 AAACCTAGAAAAATCTCTTCTGG + Intronic
1068351307 10:55849063-55849085 AATCCTAAAATCAACTCATCTGG + Intergenic
1070975958 10:80605887-80605909 AAACCTAGAATTTGTCCCTCAGG + Intronic
1072671483 10:97433025-97433047 CAACCTAGAGCCAGATCCTCTGG - Exonic
1072870150 10:99110327-99110349 AAACGTAGAAACTGCTCCTCAGG + Intronic
1073719017 10:106144028-106144050 AAACCTAGGACCAGCAACTCAGG - Intergenic
1079133306 11:17762040-17762062 AAATCCAGAGACAGCTCCTCCGG + Intronic
1080103988 11:28492406-28492428 AAACATTGAATCAGGTCCTGTGG + Intergenic
1080675724 11:34424643-34424665 AAACCTTGAAAAAACTCCTCTGG + Intergenic
1085068723 11:73522270-73522292 TAACACAGAATCAGCTACTCAGG + Intronic
1087692998 11:101343719-101343741 AAACCTAGAAGAAACTCTTCAGG - Intergenic
1087867931 11:103256306-103256328 AAATGTAGAATCAGGTCCTCAGG + Intronic
1088705163 11:112455531-112455553 AAACCTTGATTCACCTCCTCTGG + Intergenic
1088786364 11:113185866-113185888 AAATCTTGAATCAGTACCTCCGG - Intronic
1088986289 11:114911734-114911756 AAACCTAGAAAAAACTCTTCTGG + Intergenic
1089047449 11:115515327-115515349 AAATCTAAAATCAGCACCACTGG - Intergenic
1093296774 12:17400929-17400951 AAACCGAGAAGCAGCTCCCATGG - Intergenic
1096818366 12:54215935-54215957 AACCCTAGAAAAGGCTCCTCTGG - Intergenic
1098500016 12:71181224-71181246 AAACCTAGAAAAAACTCTTCTGG + Intronic
1099148146 12:79074120-79074142 AAACCTCTAATCAGATCCTGTGG + Intronic
1099385532 12:82008434-82008456 AAACATATAATTATCTCCTCTGG - Intergenic
1099771523 12:87064680-87064702 ACACCTAGAATCATCTGATCTGG - Intergenic
1100336904 12:93640299-93640321 CAACCTAGAGCCAGATCCTCTGG + Intergenic
1101361557 12:104032044-104032066 CAACCTAGAGCCAGATCCTCTGG - Intronic
1102974590 12:117197417-117197439 AATCCTAGAATAAGTCCCTCTGG + Intergenic
1103256831 12:119548778-119548800 AAACCCAGACTCAGCTGCTTTGG - Intergenic
1103887063 12:124210471-124210493 AAACCCAGAATAATCTCATCTGG + Intronic
1104710591 12:130982935-130982957 AAGCCTAGGATGATCTCCTCCGG + Intronic
1106213139 13:27669346-27669368 TTTCCTAGATTCAGCTCCTCTGG - Intergenic
1106602085 13:31196892-31196914 AAACCTAAAATCAGGTCTTAAGG - Intergenic
1106830660 13:33578556-33578578 AAACCTAGAAAAAACTCCTTTGG + Intergenic
1108727018 13:53193877-53193899 AAATTTCGAAGCAGCTCCTCAGG + Intergenic
1108895142 13:55317117-55317139 AAACTTCAAAACAGCTCCTCGGG + Intergenic
1109636346 13:65122945-65122967 AAACCTAGAAAAAACTCTTCTGG - Intergenic
1112863976 13:103871175-103871197 AAACCTAGAAGAAACTCTTCTGG - Intergenic
1113258869 13:108538094-108538116 AAACCTAGAAAAAACTCTTCTGG - Intergenic
1113552781 13:111206020-111206042 AATCCAAGAAAGAGCTCCTCAGG - Intronic
1116302718 14:43205988-43206010 AAACCTAGGATGAACTCTTCTGG - Intergenic
1118107151 14:62672642-62672664 AAACCTTAAATCAGCTCCCCAGG - Intergenic
1118420057 14:65592543-65592565 AAGCTTAGTATCAGGTCCTCTGG - Intronic
1119443572 14:74645989-74646011 AAACCACGCATCAGCCCCTCAGG - Intergenic
1127075392 15:55320194-55320216 AAACTTAAAATCTGCTGCTCTGG - Intronic
1128683098 15:69665740-69665762 AAACAAACAAGCAGCTCCTCGGG - Intergenic
1128806378 15:70534041-70534063 CAGCTTGGAATCAGCTCCTCAGG - Intergenic
1130728003 15:86461073-86461095 CAACCTTGGCTCAGCTCCTCAGG + Intronic
1130819615 15:87480673-87480695 AATCCTAGAATCAACTCAGCAGG + Intergenic
1130859173 15:87871298-87871320 AAGCCAAGATTCAGCTCTTCAGG + Intronic
1133325922 16:4942305-4942327 AAACCTAGCATCAACTTCACAGG + Intronic
1140696655 16:77541301-77541323 AAATGTAGAATCAGTTCATCTGG + Intergenic
1141466989 16:84212787-84212809 GAACCAAGAAGCACCTCCTCAGG + Intergenic
1142511831 17:400855-400877 ATGCCTATAATCAGCTGCTCGGG - Intergenic
1143371935 17:6445725-6445747 AACTCTGGAATCACCTCCTCTGG - Intronic
1146116909 17:30148714-30148736 AAACTTAGAACCATCTCCTCTGG - Intronic
1147795814 17:43041979-43042001 AAAACTAGAAACAGCTCCTATGG - Intergenic
1150422389 17:65049779-65049801 GAATCCAGAATCAGATCCTCAGG + Intronic
1151868178 17:76818865-76818887 GAATCTAGAATGATCTCCTCTGG - Intergenic
1153273979 18:3350206-3350228 AACCCTATAATCAGCTCCACCGG + Intergenic
1157114620 18:44851470-44851492 ACACCTGGACTCAGCTCTTCTGG + Intronic
1157141784 18:45115402-45115424 AAACAAAGAATGAGCACCTCAGG - Intergenic
1157697188 18:49732317-49732339 GAAGCTTGAATCAGTTCCTCAGG + Intergenic
1158886574 18:61833575-61833597 AGCCCTAGAATCACTTCCTCAGG - Intronic
1162857706 19:13481787-13481809 AAACCTAGAAACGGTCCCTCAGG - Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
925131346 2:1496263-1496285 AAAGTTAAAATCAGCTCCTGGGG - Intronic
928563519 2:32517466-32517488 ATACCTAGAATCATGCCCTCGGG - Intronic
933776811 2:85776089-85776111 AATCCTAGAACAAGCTCCTGGGG + Intronic
934165376 2:89289592-89289614 AAATCTAGAATCAGTATCTCTGG + Intergenic
934201898 2:89892870-89892892 AAATCTAGAATCAGTATCTCTGG - Intergenic
936482518 2:112898080-112898102 AGACCTGTAATCAGCTACTCAGG - Intergenic
936968771 2:118153803-118153825 AAACTTAGCAACAGCTGCTCTGG + Intergenic
938175274 2:129120435-129120457 AAACCTAGAAAAACCTCTTCTGG - Intergenic
938245960 2:129778257-129778279 AATCCTACAGCCAGCTCCTCTGG - Intergenic
939114692 2:138047045-138047067 AAAACTAGATACAGCTTCTCAGG + Intergenic
939831200 2:147073284-147073306 AAACCTAGAAAAAACTCTTCTGG - Intergenic
946551076 2:220802515-220802537 AAATCTAAAATCAGCACATCAGG + Intergenic
946989087 2:225307883-225307905 AAAACTAGAAGAAGCTACTCTGG + Intergenic
947333882 2:229059927-229059949 ACACTTAGAATCAGTTTCTCAGG + Intronic
947698331 2:232211469-232211491 AAAACTAGAAGCAGCACATCTGG - Intronic
948790651 2:240374848-240374870 AAACCCTGAAGCAGCTCCTCTGG + Intergenic
1170009286 20:11703857-11703879 AACCCTAGAATCAGAAACTCTGG + Intergenic
1173197965 20:40931580-40931602 CAACCTAGAAGCAGCTGCACAGG + Intergenic
1173717134 20:45218396-45218418 AAACCAAGAAACAGCTTCACAGG - Intergenic
1174306368 20:49616786-49616808 ATCCCTAGAATGGGCTCCTCGGG - Intergenic
1174874609 20:54213234-54213256 TAAACTAGAATCAGGTGCTCTGG + Intronic
1175608480 20:60330742-60330764 AAACCAAAACTCAGCACCTCTGG + Intergenic
1175690176 20:61059556-61059578 AATCCTAGAATCAGCTGGGCAGG - Intergenic
1176124848 20:63470851-63470873 AAAGCTAGACTCACCTCCTGGGG + Intronic
1177367797 21:20160008-20160030 AAACCTAGGAAAAACTCCTCTGG + Intergenic
1177409234 21:20708406-20708428 AAATCTAGAGTGAGCTCCTGTGG - Intergenic
1179552476 21:42152016-42152038 TAAACTAGAATCAGCTGTTCTGG + Intergenic
1182787433 22:32919376-32919398 AACTCTAGTATCAGCTCCACAGG + Intronic
1182947622 22:34339461-34339483 GAACCTTGTATCAGCTCCTGAGG - Intergenic
1184908373 22:47508299-47508321 AAACCTAGAAAAAACTCTTCTGG + Intergenic
949230185 3:1741758-1741780 AAGCCAAGAATCAGCTACTAGGG - Intergenic
950297720 3:11846554-11846576 AAAGCCAGACTCAGCTCCTCGGG + Exonic
954247305 3:49341699-49341721 ACACCTAGTCTCAGCTACTCGGG + Intergenic
954286488 3:49623202-49623224 AAACTTAGAATCTTCTCCTGGGG + Intronic
955862673 3:63348614-63348636 AAACCTAGAGAAAGCTCTTCTGG - Intronic
959139773 3:102471680-102471702 AAACCTAGAACCAGTTTTTCCGG - Intronic
959939144 3:112061926-112061948 AAGCCTAGGATCACCTCCTTAGG + Intronic
962234463 3:133695230-133695252 AAAAAAAGAACCAGCTCCTCTGG - Intergenic
962881192 3:139578286-139578308 AAATCTAGAAACAGTTACTCTGG - Intronic
971170277 4:24226535-24226557 AAGCAAAGAATTAGCTCCTCTGG + Intergenic
972219186 4:36934854-36934876 AAACCTAGGAAAAACTCCTCTGG + Intergenic
973773625 4:54227211-54227233 ATCCCTGGAGTCAGCTCCTCAGG + Intronic
976308272 4:83583167-83583189 ACACCTAGTCTCAGCTACTCGGG + Intronic
976567568 4:86568849-86568871 AAACCTAGGAATAGCTCTTCTGG + Intronic
977611474 4:99037807-99037829 AAATTTAGAATCAGCTTGTCTGG + Intronic
979339810 4:119509224-119509246 AAACCAAGAATTGGTTCCTCTGG + Intronic
980378576 4:131978608-131978630 AAATCTAGGAACAGCTCTTCAGG + Intergenic
981252014 4:142614448-142614470 AAACCTAGGAAAAACTCCTCTGG + Intronic
983423048 4:167545354-167545376 AAACCTAGAAAAAACTCTTCTGG - Intergenic
984439051 4:179742680-179742702 TAAGCTAGAATCAGTTCCTTAGG + Intergenic
988617718 5:32791919-32791941 AAACCTTGAATCAGCTGGTAAGG + Intergenic
989343418 5:40402923-40402945 AAACCTAAATTCATCTCTTCAGG - Intergenic
990115609 5:52386946-52386968 AAACCCAGAAGCAGCTCTGCTGG + Intergenic
991494255 5:67212001-67212023 AAATCTAAAATCAATTCCTCTGG + Intergenic
992581414 5:78182183-78182205 AAACCTAGAATCAGCTCCTCTGG - Intronic
994073594 5:95627868-95627890 AAACTTACAATCTGCTCCTGGGG + Intergenic
995055864 5:107758036-107758058 ATGCCCAGAATCAGCTTCTCAGG + Intergenic
995195943 5:109368565-109368587 AAACCAAGAATTATCTCTTCAGG - Exonic
995918452 5:117279938-117279960 CAACCTAGAATCAGAAACTCTGG - Intergenic
996503999 5:124248640-124248662 AAACCTAGGAAAAGCTCTTCTGG + Intergenic
997604364 5:135163493-135163515 AAACTGAGAACCAGCTCCTGTGG + Intronic
997886227 5:137632562-137632584 AAACCTAGAAAAAACTCTTCTGG + Intronic
1001498974 5:172213705-172213727 ACACCTAGTCTCAGCTACTCAGG - Intronic
1002910991 6:1490922-1490944 ACAGATAGAACCAGCTCCTCAGG + Intergenic
1003704091 6:8504845-8504867 AAACATAGAATCAGTTTCTCAGG - Intergenic
1005161924 6:22874205-22874227 AAACCCAGAATGATCTTCTCAGG + Intergenic
1005314166 6:24588257-24588279 TATCCTAGCATCATCTCCTCTGG + Intronic
1006998573 6:38286246-38286268 AAACCCAGCATCAACTCCTTAGG + Intronic
1007579514 6:42948701-42948723 ACACCTGTAATCAGCTACTCAGG - Intergenic
1008438649 6:51506820-51506842 AAATCTAGAATAAACTCTTCTGG + Intergenic
1009753082 6:67898314-67898336 AAACCAAGAATCAGATCATTTGG + Intergenic
1011035322 6:82967764-82967786 ACCTCTAGAATCAGCTTCTCAGG - Intronic
1011942098 6:92856008-92856030 AAATCTAGCATGAGCTCCCCAGG - Intergenic
1012084979 6:94813073-94813095 AATCCTAGAATCAGCTATTCTGG + Intergenic
1012700096 6:102445332-102445354 AAACCTAGGATAAACTCTTCTGG - Intergenic
1012898517 6:104979332-104979354 ACACCTGTAATCAGCTACTCGGG - Intronic
1014129954 6:117819535-117819557 AAACCTAAAATGAGGTCCTTAGG + Intergenic
1014145985 6:117998914-117998936 ATACCTAAAATCAGCTCTTCCGG + Intronic
1015543772 6:134342079-134342101 AGGTCTGGAATCAGCTCCTCCGG + Intergenic
1016425192 6:143928206-143928228 AAACCTAGGAACAACTCTTCTGG - Intronic
1019897637 7:3995056-3995078 AAGCCTAGAATCCCCTCTTCAGG - Intronic
1020141680 7:5615223-5615245 AGATCTTAAATCAGCTCCTCGGG - Intergenic
1020569241 7:9837554-9837576 AAACCTAGAATGAGATCATTGGG - Intergenic
1021627835 7:22612002-22612024 AGACCAAGCATCAGTTCCTCAGG + Intronic
1022945662 7:35281278-35281300 AACACTAGAAACAGCTCCTAAGG + Intergenic
1025012665 7:55410052-55410074 AAACCTAGAATCAGTAACTCAGG + Intronic
1026821856 7:73555278-73555300 ACACTTATAATCAGCTACTCGGG + Intronic
1028052906 7:86207532-86207554 ACACCTAGTCTCAGCTACTCAGG - Intergenic
1028348240 7:89810640-89810662 AAAACTAGAAAAAGCTCTTCTGG + Intergenic
1030385892 7:108867761-108867783 AATCCTAGAATCACAACCTCCGG - Intergenic
1030385904 7:108867955-108867977 AATCCTAGAATCACAACCTCCGG - Intergenic
1030385916 7:108868149-108868171 AATCCTAGAATCACAACCTCCGG - Intergenic
1030507680 7:110445370-110445392 TGACCTAGGACCAGCTCCTCAGG + Intergenic
1032488563 7:132306678-132306700 AGACCCAGAATCAGCTTCTCAGG - Intronic
1037148689 8:15608056-15608078 AAACCAAGAATAAACTACTCTGG - Intronic
1037209282 8:16365937-16365959 AAACCTAGAAAGAGCTCTTCTGG + Intronic
1038984386 8:32792680-32792702 AAACAGAGAATCCGTTCCTCTGG + Intergenic
1039367824 8:36950305-36950327 GAACTTAGCATCAGCTGCTCAGG - Intergenic
1041577235 8:59412920-59412942 AAACCTAGGAAAAACTCCTCTGG - Intergenic
1042098778 8:65249229-65249251 ATACTTAGAAACAGCTCATCAGG - Intergenic
1049418821 8:142507818-142507840 AAACCCAGTATCAGCTGCACAGG + Intronic
1050736205 9:8766123-8766145 AAACCTAACAGCAGGTCCTCAGG + Intronic
1051038312 9:12775996-12776018 AAACCAAGCTTCACCTCCTCAGG + Exonic
1052332111 9:27280842-27280864 GAACCTAGGATCAGTTCCTACGG - Intergenic
1057772321 9:97979819-97979841 AATCCTAGCAACAGCTCCCCGGG - Intergenic
1058053628 9:100428857-100428879 AAACCCAAAATAATCTCCTCAGG - Intronic
1061871907 9:133525411-133525433 AATCCTTGAATTAACTCCTCTGG - Intronic
1188080380 X:25831754-25831776 AAACCTAGAAAAAACTCTTCTGG - Intergenic
1189756034 X:44272089-44272111 CAACCTAGGATTAGCTTCTCTGG + Intronic
1190336658 X:49266823-49266845 ATCACTAGAATCAGCTCCCCAGG - Intergenic
1191644008 X:63459266-63459288 AATCCTGGAATAAGCTCCCCAGG - Intergenic
1193135628 X:77968359-77968381 CAACCTAGAGCCAGATCCTCTGG + Intronic
1193902468 X:87199049-87199071 TAATCTAGAATCAGCATCTCAGG + Intergenic
1193926261 X:87488854-87488876 ATATATAGAATCATCTCCTCTGG + Intergenic
1194047564 X:89027524-89027546 AAACCTGGGATAAGCTCTTCTGG - Intergenic
1195522274 X:105845068-105845090 AAACCTAGAGACACATCCTCAGG - Intronic
1196460621 X:115925613-115925635 AAACCTAGAGTAAACTCTTCTGG + Intergenic
1197027661 X:121774411-121774433 AAACCTAGGAAAAACTCCTCTGG - Intergenic
1197686012 X:129440419-129440441 AGACCTAGATTCTGTTCCTCTGG + Intergenic
1199433568 X:147787522-147787544 AAACAGAGAATCAGCTCTTACGG - Intergenic
1201756110 Y:17487076-17487098 ACACCTGTAATCAGCTACTCAGG + Intergenic
1201845442 Y:18418909-18418931 ACACCTGTAATCAGCTACTCAGG - Intergenic
1201893986 Y:18974097-18974119 ACACCTAGTCTCAGCTACTCTGG - Intergenic