ID: 992583321

View in Genome Browser
Species Human (GRCh38)
Location 5:78204771-78204793
Sequence CCTTCTCTGCCTCAGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992583321_992583327 -7 Left 992583321 5:78204771-78204793 CCCTGTCACTGAGGCAGAGAAGG 0: 1
1: 0
2: 2
3: 27
4: 301
Right 992583327 5:78204787-78204809 GAGAAGGGAGGATAGAGTGAGGG No data
992583321_992583326 -8 Left 992583321 5:78204771-78204793 CCCTGTCACTGAGGCAGAGAAGG 0: 1
1: 0
2: 2
3: 27
4: 301
Right 992583326 5:78204786-78204808 AGAGAAGGGAGGATAGAGTGAGG 0: 1
1: 0
2: 14
3: 135
4: 1391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992583321 Original CRISPR CCTTCTCTGCCTCAGTGACA GGG (reversed) Intronic
900093941 1:932817-932839 CCTCCTCTGCCTCAGGAACCCGG + Intronic
900417815 1:2543133-2543155 CCTTCCCTCCATCTGTGACAGGG - Intergenic
900549298 1:3246147-3246169 CCTTCTGTGCCTCTGGGCCACGG + Intronic
900644628 1:3703320-3703342 CATCCTCAGGCTCAGTGACACGG - Intronic
900766755 1:4511139-4511161 CATTCTCTGCCTGAGTGAGTGGG - Intergenic
902651539 1:17840830-17840852 CTTTCACTGCCTAAGTGACCAGG - Intergenic
904032180 1:27540132-27540154 CCTTCTGTGCTTCAATGACCAGG + Intronic
904474697 1:30757360-30757382 CCGTTTCTGCCTCTGTGAGATGG - Intronic
904474844 1:30758011-30758033 CCTTCTCTGCACCAGGGCCAGGG + Intergenic
906856454 1:49311251-49311273 CTTTCTCTACCTCTGTGGCATGG - Intronic
907038320 1:51236304-51236326 CCTACTCCGCCTCAGCGAGACGG - Exonic
907489733 1:54801193-54801215 CCTCCACAGCCTCAGGGACAAGG - Exonic
907690406 1:56658908-56658930 CCTTCTCTTCCTGAGTGGCTGGG + Intronic
909856032 1:80533121-80533143 CAATGTCTGCCTCAGTGACAAGG - Intergenic
912148044 1:106818559-106818581 CCTTTTGTGGCTCAGTCACATGG - Intergenic
913529056 1:119720440-119720462 CCTTCCCTGTATCAGGGACAGGG + Intronic
914854952 1:151344039-151344061 CATCCTCTGCCTCAGCTACAGGG + Intronic
915322207 1:155062230-155062252 CCTTCTCTCCCTCAGTCTCAGGG + Exonic
916497586 1:165359134-165359156 CCTTATCCAACTCAGTGACATGG + Intergenic
917636642 1:176943564-176943586 CTCTCTCTGCCTCTGTGACCTGG + Intronic
918606752 1:186436896-186436918 TCTTCTCTGCTTCTGTGACCGGG - Intergenic
919041155 1:192390440-192390462 CTTTCTCTGCCTCTTTGAGAAGG + Intergenic
919686649 1:200489166-200489188 CCTTCTCTCCCTTAGTGTAACGG - Intergenic
919854959 1:201698914-201698936 CATTCTGGGCCTCAGTGGCAGGG + Intronic
920034499 1:203057025-203057047 CCTTCTCTGCCTGCGTCCCAGGG + Intronic
920245017 1:204580850-204580872 TGCTCCCTGCCTCAGTGACAGGG - Intergenic
921159675 1:212464130-212464152 CCTTCCCTCCCTCAAGGACAAGG + Intergenic
922330869 1:224574511-224574533 CCTTCACAGCCTCAGTTACCTGG - Intronic
922891902 1:229068096-229068118 CCTGCCCTGCCTCAGTGAAGGGG - Intergenic
922967140 1:229699762-229699784 CCCTCTCTTCCTCATTTACAGGG + Intergenic
1062766320 10:68558-68580 CCATCTCTGCTTTACTGACATGG + Intergenic
1062907545 10:1189002-1189024 CCATCTCTTCCTCACCGACATGG + Intronic
1067570729 10:47369119-47369141 CCTACTCTGCCTCAGGGAGGTGG - Intronic
1067938305 10:50630373-50630395 TCTTGTCTCCTTCAGTGACACGG + Intergenic
1068443447 10:57089746-57089768 CCTTCACTCCCTCAGCTACATGG - Intergenic
1069813113 10:71177148-71177170 CCTTCCCTGCCTCATTGCCAAGG - Intergenic
1071273872 10:84034909-84034931 GCCTCCCTGCCACAGTGACAGGG - Intergenic
1072546785 10:96446209-96446231 CCTTCTCTGCATCAGCACCAAGG + Intronic
1073005107 10:100317501-100317523 TGTACTCAGCCTCAGTGACAGGG + Intronic
1074565945 10:114578021-114578043 CCTTCTCAGTCTCAGTGGCCAGG + Intronic
1077319470 11:1934814-1934836 CTTCCTCTGCCCCAGGGACAAGG + Exonic
1078976554 11:16484572-16484594 CCTTCACAGCCTCAGTCACCTGG + Intronic
1079598239 11:22279950-22279972 ACTTCTCTGCTTCATTGACTGGG + Exonic
1081273717 11:41120703-41120725 CCTTCTCTTGCTAAGTGATATGG + Intronic
1081457882 11:43243317-43243339 CCTACTCTGCCTCAGGGCGAAGG - Intergenic
1081482747 11:43504661-43504683 CCATCTCTAGCTCAGGGACAAGG + Intergenic
1083151138 11:60792549-60792571 CCTTCTCTGCCTCACTGCACTGG - Intronic
1083172588 11:60931797-60931819 CCTTCTCTGCTTCAGGGGCCTGG - Exonic
1084382001 11:68818472-68818494 CCAGCTCTGCCTCAATGACTCGG + Intronic
1084399180 11:68933774-68933796 CCCTCTCTGCCTGTGTGCCAGGG + Exonic
1084661754 11:70550285-70550307 TCTCCTCTGCCTAACTGACATGG - Intronic
1085044385 11:73344607-73344629 CTTTCTCCCCCTCAGTGAGACGG - Intronic
1085083676 11:73652797-73652819 CCTCCCCTGCCCCAGTCACATGG - Intronic
1085569705 11:77548692-77548714 CTTTCTCAGCCTCAGAGATAAGG + Intronic
1086613334 11:88783696-88783718 TCATCTGTGCCTCAGTCACATGG - Intronic
1088688004 11:112300662-112300684 CCGTCTCTTCCTCCGTGAAATGG - Intergenic
1089290997 11:117437865-117437887 CCTTCCCTGCCCCAGTGGCCTGG + Intronic
1089362854 11:117902483-117902505 CCTTCTCTGCCTGGGGAACAGGG - Intronic
1089470368 11:118715746-118715768 CCTGCTCTGTCTCAATCACAGGG - Intergenic
1090265181 11:125349065-125349087 CCTTCTCTGCCAGAGTTCCAGGG + Intronic
1090599415 11:128354959-128354981 CCTTCACTGCCCCAGTGCCCTGG + Intergenic
1090830087 11:130415213-130415235 CCCTGTCTCCCTCAGTGAGAAGG + Intronic
1091221927 11:133934891-133934913 CCTTTGTTGCCTGAGTGACAGGG + Intronic
1093137817 12:15473038-15473060 CCTGCTCAGACCCAGTGACAGGG + Intronic
1094142020 12:27191172-27191194 CCAGCTCTGTCTCACTGACAGGG + Intergenic
1096245601 12:49983775-49983797 TCTCCTCTCCCTCAGTGCCAGGG + Intronic
1097429404 12:59486019-59486041 CTTTCTCTGCCTGAGTGGCCTGG + Intergenic
1098217134 12:68232956-68232978 CGTTGACTGCCTCAGGGACACGG - Intergenic
1099799974 12:87444385-87444407 CCTCCTCTGACTCATTAACAGGG - Intergenic
1101882292 12:108633792-108633814 GCTTCTCTGCTTTAGTGACAAGG + Intronic
1102296554 12:111741369-111741391 CCTGCTCTGCTCCAGTGACCTGG + Intronic
1102314400 12:111875313-111875335 TCTTCAGTGCCTCAGTGGCATGG + Intronic
1103841508 12:123869161-123869183 CCTACTCTGCCTCTGAGACTCGG + Intronic
1105546659 13:21355690-21355712 CCTTATTTTCCACAGTGACATGG - Intergenic
1106110561 13:26772879-26772901 CTTTCTGTGTCTCAGTGATAGGG + Intergenic
1107390015 13:39953990-39954012 CCTCCTCAGCCACATTGACACGG + Intergenic
1107617489 13:42185395-42185417 CTCTGTTTGCCTCAGTGACATGG + Intronic
1107679316 13:42831923-42831945 CTTTCTTTGCCTTAGTGTCAAGG + Intergenic
1107726876 13:43307924-43307946 CCTCCTCTCCCACAGTGAAAAGG - Intronic
1107822363 13:44297270-44297292 TCCTCTCTGCCTCACTGGCATGG - Intergenic
1108538570 13:51413103-51413125 CTTTCTGTCCCACAGTGACAAGG - Intronic
1110308913 13:74023593-74023615 CAATCTCTGCCTCTGTGACATGG + Intronic
1110883900 13:80608557-80608579 CTCTCTCTGCCTCATTGAAAAGG - Intergenic
1111618451 13:90692644-90692666 TCTTCTTTGTCTCATTGACAGGG + Intergenic
1112802838 13:103131649-103131671 CCTTCCCTGACTCAGTCCCAAGG - Intergenic
1113368785 13:109704348-109704370 CTTTCCATGCCACAGTGACAAGG + Intergenic
1113752429 13:112785504-112785526 CCTGCACTGCCTCTGTGGCACGG - Intronic
1114255173 14:20995585-20995607 CATACTCTCCCCCAGTGACAAGG - Intronic
1114328402 14:21612591-21612613 CCATCTCTGCCTCAGTGCCATGG + Intergenic
1114622295 14:24103455-24103477 CCTTCCCTACCCCAGTGAGAAGG + Intronic
1115280481 14:31656268-31656290 CTTTCTCTGTCTCAGTGATAGGG + Intronic
1115305296 14:31927697-31927719 CCATCTCTGCCCTAGTCACATGG + Intergenic
1118057639 14:62098003-62098025 ACTTCTCTGTCTCAGAAACAGGG - Intronic
1118138114 14:63050024-63050046 CTTCCCCTGCCTCAGTGACTAGG + Intronic
1118266055 14:64295565-64295587 ACTTCTCTGCCTCAAGGACAGGG - Intronic
1119528322 14:75340973-75340995 CCTCCTTTGCCCTAGTGACACGG + Intergenic
1119682374 14:76602521-76602543 CCATCTATGCCTCAGTCAGAGGG + Intergenic
1119772305 14:77227825-77227847 CCTTCTCTGCCTCTGTGTCTTGG - Intronic
1120673817 14:87395318-87395340 CCTTCTGTGGTTCAATGACACGG - Intergenic
1120844768 14:89116105-89116127 CCTACTCTGTCTCAGCTACATGG + Intergenic
1121787904 14:96676415-96676437 CCTTCTCTGCCTGACTCAGAGGG + Intergenic
1122153242 14:99735791-99735813 CCTTTTCTGGCTCAGGGACCTGG - Intergenic
1122317685 14:100835569-100835591 CCTTCTCTGCCTCAGTCCCTGGG + Intergenic
1122338349 14:101008237-101008259 CCTTCCCTGCTTCCCTGACATGG + Intergenic
1124274202 15:28312013-28312035 CCTTGTCTTTCTGAGTGACAAGG + Intronic
1124562825 15:30791464-30791486 CCTCCTCTGGCTCAGTCACACGG + Intergenic
1124688570 15:31802999-31803021 CCTTCTCTCCCTCAGCCAAAAGG - Intronic
1127133287 15:55890985-55891007 CTTTCTGTCCCTCAGTGACCAGG - Intronic
1128202873 15:65824534-65824556 TGATCTCTGCTTCAGTGACAGGG - Intronic
1129699875 15:77761716-77761738 GCTTCTCAGCTTCAGGGACATGG + Intronic
1130767931 15:86891695-86891717 CCTTCTCTACTCAAGTGACATGG + Intronic
1132834847 16:1947589-1947611 CCTTCTGTCCCCCAGTGAGATGG - Intronic
1133387907 16:5385597-5385619 CCTTATGTGCCAAAGTGACATGG + Intergenic
1133853310 16:9526266-9526288 CCTTCTCTTCCACAATCACAGGG - Intergenic
1134875882 16:17698191-17698213 ACTTCCCTGTCTCAGTGTCAGGG - Intergenic
1136170341 16:28485627-28485649 CCTTGCCTGCCTGAGTGCCAGGG - Intronic
1137241957 16:46663279-46663301 CCTTCTCTGTTTCAGTTATAGGG + Intronic
1137268931 16:46890064-46890086 TCTTCCCTGCCTCAGTGATCTGG + Intronic
1138442106 16:57041391-57041413 CATTCTCTGCCTCTGTGTCTGGG + Intronic
1139709996 16:68768865-68768887 CACTCTCTGCCTCAGGGCCATGG + Intronic
1140342987 16:74183777-74183799 CCTTCCCACCCTCAATGACAAGG + Intergenic
1140899230 16:79352704-79352726 GCTTCTCGGCCTCAGTGCTATGG + Intergenic
1141389867 16:83655559-83655581 CCTTTTCTCCCTCATTCACATGG - Intronic
1141395569 16:83701614-83701636 TCTTCTCTGCCTCTGTGCTAGGG + Intronic
1141570656 16:84931706-84931728 CCCTCTCTGCCTGAGTCACAAGG - Intergenic
1143225376 17:5297745-5297767 CCTTCTCTCCATCTGTAACAAGG - Intronic
1143909317 17:10234754-10234776 GCTTCTGTTCCTCAGGGACAGGG - Intergenic
1144711715 17:17405669-17405691 CCACCTCTGACTCAGTGACTTGG - Intergenic
1145792933 17:27639089-27639111 GCCTCTCTGCCTCAGTCCCAGGG + Intronic
1145807795 17:27746956-27746978 GCCTCTCTGCCTCAGTCCCAGGG + Intergenic
1146523935 17:33549840-33549862 CCTCCTCCACCTCAGTGACTTGG + Intronic
1146747703 17:35346548-35346570 CCTTCTCTGTCTAAGGGGCAGGG + Intergenic
1148090030 17:45017987-45018009 TCTGCTCTGCCAGAGTGACAGGG - Intergenic
1148440965 17:47711396-47711418 CGATCTGTGCCTCAGTGCCAGGG - Exonic
1148824082 17:50379324-50379346 CCTTCTCTTAGTCAGTGCCAAGG - Intronic
1149047422 17:52264120-52264142 TCTTCTCTGCCTCTTTCACAGGG + Intergenic
1149505474 17:57190423-57190445 CAGTCTCTGCCCCAGTGACCAGG + Intergenic
1151150704 17:72083660-72083682 CCATCTCCCTCTCAGTGACATGG - Intergenic
1151355490 17:73555619-73555641 CCCTCTCTGCCTCAATGTCCCGG + Intronic
1151908365 17:77064587-77064609 CACTCTCTGCCTTAGTGCCAAGG - Intergenic
1152283126 17:79396952-79396974 CGTTCCCTGCCGCTGTGACAGGG - Intronic
1152484865 17:80583899-80583921 CCGCCACTGCCTCAGTGACATGG - Intronic
1153327191 18:3832866-3832888 ACTCCTCTGCCTCAGTGATGGGG - Intronic
1153554885 18:6302057-6302079 CGTTGTCCGCCTCAGTGACGAGG - Intronic
1154417232 18:14185571-14185593 CTTTCTCTACATCAGTGACTAGG + Intergenic
1156154430 18:34284917-34284939 ACTTTTTTGACTCAGTGACAAGG + Intergenic
1156845491 18:41661207-41661229 CCTTCTCTGCCCAGATGACAAGG - Intergenic
1157725484 18:49960419-49960441 CCTCCTCAGGCTCAGAGACATGG + Intronic
1158114834 18:53983644-53983666 CCTTCTCTGACATATTGACATGG + Intergenic
1158161849 18:54493729-54493751 CCTACTCTTCCACAGAGACAGGG - Intergenic
1161038741 19:2099026-2099048 CCTTCTCTGGGTCACTCACAAGG - Exonic
1161471747 19:4460732-4460754 CCACCTCTGCCTCAGTTACCTGG + Intergenic
1161501696 19:4619736-4619758 CCGTCTCTGCCTCAGTACCTGGG - Intergenic
1162090505 19:8276674-8276696 CCTTCTCAGCCTCTGCCACAAGG + Intronic
1162092738 19:8291502-8291524 CCTTCTCAGCCTCTGCCACAAGG + Intronic
1162216722 19:9140614-9140636 CCTTCTCCCCCTCAGTTCCAGGG + Intronic
1163193386 19:15696522-15696544 CCATCCCTGCCTCAGACACAGGG - Intronic
1163684183 19:18701276-18701298 CCTTCTGTGCCTCAGTTTCCTGG + Intronic
1163827029 19:19529567-19529589 CCTCCTCAGCCTTTGTGACATGG + Intronic
1164618046 19:29678326-29678348 CCCTCTGTGCCTCAGTGGCCAGG - Intergenic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165826876 19:38710562-38710584 CCTTGTCTGACTCAGTCACCAGG - Intronic
1166181892 19:41114502-41114524 CCTTCTCTGCCTCCCTCACCGGG - Intronic
1166677161 19:44747453-44747475 CCTCCTGTGACTCAGTGACCCGG + Intergenic
1167137114 19:47623424-47623446 ACCTCTGTGCCTCTGTGACAGGG - Intronic
1168521216 19:57052231-57052253 CCTTCCCTTCCTCAATTACAGGG + Intergenic
925421148 2:3712967-3712989 CCTGCTCTGCCTCACTCACATGG - Intronic
925502593 2:4522668-4522690 CCCTCTCCACTTCAGTGACACGG + Intergenic
926710624 2:15876677-15876699 CCTGCTCTGCATCTGTGGCATGG - Intergenic
927859179 2:26549833-26549855 CCCTTCCTGCCTCAGTGCCAGGG - Intronic
928433857 2:31241096-31241118 CCTGCTTGGCCTCAGTGACTGGG - Intronic
929694759 2:44104772-44104794 CATTCTCTTCCTCATTTACAGGG + Intergenic
932839873 2:75072178-75072200 CCTTCTCTCCCTCTGTGCCCTGG - Intronic
933408776 2:81897940-81897962 TCTTCCCTGGCTCAGTGACACGG - Intergenic
933602753 2:84349717-84349739 CCTTTTCTGCCTCTGAGACAGGG + Intergenic
934932740 2:98441620-98441642 CCTTCTTTAACTCAGTGTCAAGG - Intergenic
935734723 2:106097431-106097453 CTTTCCCTGCCTCCGTGTCATGG + Intronic
935979574 2:108613629-108613651 CCTTTGCTGCCTCAGAGAGAGGG + Intronic
938014292 2:127854871-127854893 CCTACACTGCCTCAGTGTTAAGG - Intronic
938744825 2:134267517-134267539 CCTTCTGTGACTGTGTGACATGG - Intronic
938802735 2:134777862-134777884 CCTTCTTTGCTTCAGAGAGAAGG + Intergenic
939568331 2:143811297-143811319 CTATCTCTGCCCCAGTGAGAGGG - Intergenic
939570491 2:143834392-143834414 CTTTTTCTTCCTCAGTCACATGG + Intergenic
941031998 2:160522948-160522970 CCATCTCTGCCTCAGTTTCCTGG + Intergenic
944061431 2:195573064-195573086 CCTACTCTGAATCAGTCACATGG + Intergenic
944677799 2:202048734-202048756 CCATCTCTGCCTCTGTCACATGG - Intergenic
944836282 2:203583302-203583324 CTTTCTTTGCCTCTGTGAAATGG + Intergenic
948236514 2:236394888-236394910 CCATCTCTGCCACAGAGATATGG + Intronic
1169630544 20:7626026-7626048 CCCCCTCTGCCTCAGTGCCCAGG + Intergenic
1170019488 20:11820159-11820181 CCTTGTCTGACTCAGTGACCTGG + Intergenic
1170480288 20:16758566-16758588 CCTTCTCTCCCTCAGTCTCTTGG + Intronic
1170663121 20:18361879-18361901 CCTTCTCTCTCTCAATGTCACGG + Intergenic
1170914840 20:20612809-20612831 CCTTCTCTGCCCTGGCGACAGGG - Intronic
1171243368 20:23588825-23588847 CTGTCTCTGCCTCATTTACATGG + Intergenic
1171477008 20:25418534-25418556 AGTTCTTTGCCTCAGTGACTAGG - Intronic
1172076089 20:32298685-32298707 CCTTCCCTTCTTCAGAGACAGGG + Intronic
1172432138 20:34900917-34900939 CCTTCTCCTCCTAAATGACATGG - Intronic
1172786435 20:37471926-37471948 CCTGCCCTGCCTCAGGGACTGGG - Intergenic
1173644475 20:44625159-44625181 TCTGATCTGCGTCAGTGACAAGG + Intronic
1173949593 20:46979513-46979535 CCTTCCCTGCCTTCGTGAAAGGG + Intronic
1174162422 20:48561057-48561079 TCTTCTCTTCCCCAGTGACAGGG - Intergenic
1174349803 20:49958802-49958824 CCTTCCCTGACTCTGTGTCAGGG - Intergenic
1174392443 20:50226337-50226359 CCTTCTCTGAGCCATTGACATGG + Intergenic
1174426445 20:50434889-50434911 CCTTCTGTGCCTCAGGGAGAAGG - Intergenic
1174914367 20:54639303-54639325 CCTTCTCTACCTCTGTCACCTGG + Intronic
1175980046 20:62734144-62734166 CCTTCTCTGGCTCAGCCACGTGG + Intronic
1178780901 21:35602905-35602927 GCTTCTCTGCCTGCTTGACAGGG - Intronic
1178976812 21:37227536-37227558 CCTTCGGTCCCTCAGTGCCAGGG - Intronic
1179279140 21:39919136-39919158 CTTTCTCTGCCTCAAGGGCAAGG + Intronic
1179924863 21:44528843-44528865 CCTTTTCTGCCTCAATGGGATGG - Intronic
1181382409 22:22516860-22516882 CCTGGTCTGCCTCAGTCCCATGG + Intronic
1183055059 22:35300058-35300080 CCCTCCCTGCCTCCGTGACTAGG - Intronic
1183463996 22:37969921-37969943 ACTTCTCTGTCACAGTGGCATGG - Intronic
1184549335 22:45196212-45196234 ACTCCTCTGCCTCAGTGAGCTGG + Exonic
1185041639 22:48507330-48507352 CCACCCCTGCCTCAGTGACTTGG - Intronic
950707311 3:14791006-14791028 CCTGCTCTGCCTTAGTTAAAAGG - Intergenic
951878393 3:27454528-27454550 CATTCACTTCCTCAGTAACAAGG + Intronic
952859399 3:37800378-37800400 CTTTCTCTTCCTCTGTGAAATGG - Intronic
952899745 3:38102163-38102185 CCTTCTCTCCCCTATTGACAAGG + Intronic
955036421 3:55272644-55272666 CTCTCTCTGCCTTACTGACAGGG + Intergenic
955344863 3:58153421-58153443 CAATCTCTGCCTCAGTCACACGG - Exonic
956806371 3:72817232-72817254 TCTTCTCTCCTTCAGTGACACGG + Exonic
958733187 3:97980005-97980027 CCTTCTCTGCATCTGTGTCTAGG + Intergenic
958872782 3:99580639-99580661 CTTTATCTGCCTCAGAGAAAAGG - Intergenic
959875006 3:111372641-111372663 CCTTTTCCTCCTCAGTGACTTGG - Intronic
961822936 3:129584514-129584536 CCTGCCCAGCCTCAGTGGCATGG - Exonic
962968881 3:140380642-140380664 CCTTCTCTGCCTCACTGACTGGG + Intronic
963271155 3:143286983-143287005 CCTTCTCTGTCTCAGTACCTTGG + Intronic
963776207 3:149443924-149443946 TCTTCTCTACCTCAGTGTCTAGG - Intergenic
964545215 3:157826947-157826969 CCATCTCTGCCTCAGTACCCTGG + Intergenic
966353238 3:179054307-179054329 CCTTCTCTGCCTCATGAAGAAGG - Intronic
966920704 3:184609786-184609808 CCTTTTCAGCCCCAGTGCCATGG + Intronic
967202288 3:187082859-187082881 CCTTCTCTGCTTCAGAGAAAGGG - Intergenic
969326740 4:6448574-6448596 CCTTCTCTCCCTCCGTCTCAGGG + Intronic
969410104 4:7022391-7022413 CCTTCACTGACTCAGTGTAAAGG + Intronic
970307363 4:14747581-14747603 CCTTCTCTGTTTCAGGAACATGG + Intergenic
971167226 4:24196620-24196642 CCCTCTCATCCTCAGAGACAAGG + Intergenic
974549392 4:63350762-63350784 CCTTCAGTGCCTCTGTGATAAGG - Intergenic
975577626 4:75878338-75878360 CCTGCTGTGCCTCAGTGCTATGG + Intronic
977677017 4:99759175-99759197 CCCTCTCTCCCACAGTGATATGG + Intergenic
978285193 4:107069274-107069296 GCTTCTCTGACTCAGTGTCCTGG + Intronic
979011663 4:115378153-115378175 CTTTTTATGCCTCAGTGCCATGG + Intergenic
979323200 4:119348339-119348361 CATTCTCTTGCTCAGGGACAGGG + Intergenic
980821460 4:138022793-138022815 CCTTCCCTGCCTAAGTGAAATGG + Intergenic
981223989 4:142270022-142270044 GTTTCTCTGCCTTAGTGAAAAGG + Intronic
982093473 4:151899567-151899589 GCTTCTCTGTCTCTGGGACATGG - Intergenic
983082648 4:163406082-163406104 CTTCCTCTCCCTCAGTGGCATGG - Intergenic
983241032 4:165232977-165232999 CATTCTCTTGCTCAGGGACAGGG + Intronic
984439678 4:179750485-179750507 CCTTTTCTGCCTCTCTCACATGG - Intergenic
985707115 5:1407887-1407909 TTTTCTCTGCCTCAGAGCCATGG - Intronic
985891587 5:2720006-2720028 CCTTTTCTCCCTCAAGGACATGG - Intergenic
987089503 5:14498504-14498526 CCATCTGTGCCGCAGTGACCTGG + Exonic
991012800 5:61901388-61901410 CCTTCTCTGCATCAGGGAAATGG + Intergenic
991414400 5:66377498-66377520 ACTTTACTGGCTCAGTGACATGG - Intergenic
991480485 5:67073184-67073206 CCTGCTCTGGCACAGTGCCATGG - Intronic
992583321 5:78204771-78204793 CCTTCTCTGCCTCAGTGACAGGG - Intronic
994072672 5:95620253-95620275 CCTCCTCTTCCTCCGGGACAAGG + Exonic
995435832 5:112134194-112134216 CCTTCTCTGCCTAATTGCCCTGG + Intergenic
995713659 5:115060344-115060366 CCTTCTCTGCCTAATTGCCCTGG - Intergenic
996395573 5:123010393-123010415 CATTCTCTGCCTCAGTCTCCTGG + Intronic
998375010 5:141684706-141684728 CCTTCTTTGGCTCAATGATATGG + Intergenic
998870662 5:146548452-146548474 CCTTCTCTGCCCCAGTATCCAGG + Intergenic
999779081 5:154834842-154834864 CCTTCTGGAACTCAGTGACATGG - Exonic
999908319 5:156168021-156168043 CTTTCTGTGCCTCAGAGAAATGG + Intronic
1000191548 5:158915669-158915691 CCTTGTCTCCCTCCGTGAAAAGG - Intronic
1001280576 5:170383587-170383609 CTTTCTCAGCCTCGGGGACAGGG + Intronic
1001745437 5:174089125-174089147 CCTTCTAAGGCTCACTGACAAGG + Intronic
1003433138 6:6058674-6058696 CCTTCTCTGCCTCTATTAAAAGG + Intergenic
1004110859 6:12717391-12717413 ACTTCTCTGCCTAAGAGATAGGG + Intronic
1005272719 6:24183448-24183470 CCCTCTCTGCCTTAGTGTCTTGG - Intronic
1006428787 6:33982633-33982655 ACTTCTCTGCCTCAGGAACGAGG - Intergenic
1007768641 6:44176566-44176588 CCATCTCTGCTCCAGTGCCAGGG + Exonic
1008762675 6:54871960-54871982 CCTTGAATTCCTCAGTGACATGG + Intronic
1010076557 6:71804758-71804780 CCTTCTCTAACTCATTGATATGG + Intergenic
1011023121 6:82836349-82836371 CCTTCCCTGCCTCACTGCCCTGG + Intergenic
1012849348 6:104428367-104428389 CGTTCTCTTCCTCAGTTTCATGG + Intergenic
1013294478 6:108746579-108746601 CCTTCCCTGACTCACTGACTTGG + Intergenic
1015212149 6:130710546-130710568 TCTTCTCTGCCTCAAAGACTGGG + Intergenic
1015675846 6:135747663-135747685 CCCTCTCTGCCTCACTGATCAGG - Intergenic
1016553536 6:145309535-145309557 CCTCCTCTCCCTCCGTCACAGGG + Intergenic
1019189074 6:170239703-170239725 ACTTCTCTGTCTCAGAGCCACGG + Intergenic
1020278401 7:6637766-6637788 CCTTCTCGGCCGCAGCGGCAGGG + Intronic
1021604126 7:22393508-22393530 CCTTCTCTGCCCCCGAGACAGGG - Intergenic
1022484344 7:30766330-30766352 TCTTTTCTACCTCAGGGACATGG + Exonic
1022984690 7:35640103-35640125 ACTTCTCTGCCTCAGTGGTATGG - Intronic
1024014987 7:45305545-45305567 CCCTCTCTGCCTCATTCCCAAGG - Intergenic
1025828506 7:65030419-65030441 CCTCCTCTTCCTCCTTGACAGGG - Intergenic
1026273012 7:68852823-68852845 CTTTATCTTCCTCAGTGCCAGGG - Intergenic
1026273165 7:68853781-68853803 CTTTATCTTCCTCAGTGCCAGGG + Intergenic
1026881553 7:73909553-73909575 CATTATTTGGCTCAGTGACAGGG - Intergenic
1027260536 7:76461823-76461845 CCTCCTCAGCCTCGGTGAGAGGG + Exonic
1027311913 7:76959936-76959958 CCTCCTCAGCCTCGGTGAGAGGG + Intergenic
1027746155 7:82076916-82076938 CCTTCTCTTCTTCATTGACTTGG + Intronic
1028994940 7:97089914-97089936 TCTTCCCTGCCTCATTGCCAGGG + Intergenic
1030353670 7:108519803-108519825 CCTTCTCCTCCTCAGGGAGAAGG + Intronic
1034717151 7:153254119-153254141 CCTGCTCTGCTTCTGTGCCACGG - Intergenic
1035226881 7:157438571-157438593 CACTCTCTGCCTCTGTCACATGG - Intergenic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035482549 7:159198862-159198884 CAAGCTCTGCCTCAGTGACCAGG + Intergenic
1035583221 8:753194-753216 CCTCCTCTGCGTAAGTGACGGGG - Intergenic
1038432963 8:27514677-27514699 CTATCTCTGCCTGAATGACATGG - Intronic
1038941707 8:32312591-32312613 GCTGTCCTGCCTCAGTGACATGG - Intronic
1041273232 8:56130142-56130164 CATTCTCTGCTACAGAGACAGGG - Intergenic
1047145192 8:122190670-122190692 CTTTCTCTTCCTCTGTGATATGG - Intergenic
1047470257 8:125164146-125164168 CATTCTTTCCCTCAGTGAAAGGG + Intronic
1047751450 8:127883795-127883817 CATGCTCTGGCCCAGTGACACGG - Intergenic
1049012569 8:139897189-139897211 CACTTTCTGCCTCAGAGACACGG + Intronic
1049042862 8:140125365-140125387 CCTGCTCTGTGTCAGTGACTAGG - Intronic
1049071664 8:140359915-140359937 CCAGCTCTTCGTCAGTGACAAGG - Intronic
1049628392 8:143636981-143637003 TCTTCGCTGCCTCAGGGTCATGG + Intronic
1050487497 9:6149426-6149448 CCTCCTCAGGCTCAGTGCCAAGG + Intergenic
1050625600 9:7500785-7500807 CCTTCTCTGCTGCAGAGACCCGG - Intergenic
1054831215 9:69627325-69627347 CCTTCTCTCTCTCAGTCAGATGG + Intronic
1055187562 9:73474603-73474625 CTTTCTCACCCTCAGGGACAGGG - Intergenic
1055636366 9:78282891-78282913 CCTTCTCTGCCTCTGTTGCAAGG + Intergenic
1056539010 9:87555358-87555380 CCTTCTCTGTCACAGACACAAGG + Intronic
1058714416 9:107710988-107711010 CCTTCTGTCCCTCACTGAAATGG + Intergenic
1059586978 9:115617672-115617694 CCCTCTCTGCCTCTCTTACAGGG + Intergenic
1059867107 9:118527735-118527757 CATTCTCTGCATCAATGAAAAGG - Intergenic
1060390199 9:123270113-123270135 CCTTGGCTGCCTCAGACACATGG + Intergenic
1061485809 9:130919996-130920018 CCTGCTCAGCCTCAGTGCCTGGG - Intronic
1061968013 9:134026756-134026778 CCTTCTCTGCCAGGGGGACACGG - Intergenic
1062600814 9:137317908-137317930 CCCTCTGTGCCTGTGTGACATGG + Intronic
1186826666 X:13347064-13347086 CATTCTCTGCCCCACTGCCATGG + Intergenic
1187098754 X:16171024-16171046 ACATCTCTTCCTCAGTGGCACGG - Exonic
1190752441 X:53373997-53374019 CCTTTCCTGCCTCACTGGCATGG - Intergenic
1191183119 X:57582864-57582886 CCTTCTATACCTCATTGACCTGG - Intergenic
1191214256 X:57919513-57919535 CCTTCTATACCTCATTGACCTGG + Intergenic
1192059945 X:67813301-67813323 CATGCTCTGCCTCAGAGGCAAGG - Intergenic
1196560025 X:117135172-117135194 CATCCTCTGTCTCACTGACATGG + Intergenic
1199134414 X:144233971-144233993 CTTTCTCTGCCACATAGACAGGG - Intergenic