ID: 992583551

View in Genome Browser
Species Human (GRCh38)
Location 5:78207842-78207864
Sequence CTTGCTGGTTATGGTACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992583551_992583554 23 Left 992583551 5:78207842-78207864 CCAACAGTACCATAACCAGCAAG 0: 1
1: 0
2: 0
3: 12
4: 154
Right 992583554 5:78207888-78207910 AAACCATTTTCAAATGCACAAGG 0: 1
1: 0
2: 6
3: 155
4: 1576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992583551 Original CRISPR CTTGCTGGTTATGGTACTGT TGG (reversed) Intronic
900561937 1:3311536-3311558 CTGGCTGGTTTTGGGCCTGTGGG - Intronic
904914154 1:33957766-33957788 CCTGATGGTCATGGTGCTGTCGG - Intronic
910782002 1:90948774-90948796 CATGCTGGTAAGGGTTCTGTTGG - Intronic
915973978 1:160372886-160372908 CCTGCAGGTTATGGTAGGGTGGG + Intergenic
917889728 1:179424101-179424123 TTTGCTGGATATAGTACTCTTGG + Intronic
917955142 1:180088686-180088708 CTAGCTGGTTCTGTAACTGTGGG + Intronic
918788630 1:188797303-188797325 CATGCTGTTTTTGTTACTGTAGG + Intergenic
919906548 1:202082434-202082456 CTGGCTGGCTGTGGGACTGTGGG - Intergenic
922760170 1:228124074-228124096 CTTGCTCATTTTGATACTGTAGG + Intergenic
1070154684 10:73826094-73826116 CCTGGTGGTCATGGTGCTGTTGG - Intronic
1070160503 10:73863990-73864012 CTTGCTGGATGTGGCAGTGTTGG - Intronic
1071193149 10:83126005-83126027 CATGCTGTTTTTGTTACTGTAGG - Intergenic
1073437870 10:103532526-103532548 TTTGCTGGATATGGTATTATTGG + Intronic
1075324233 10:121517798-121517820 CAAGCTGGTTCTGGTCCTGTTGG + Intronic
1075443392 10:122496896-122496918 CTTGTTGGTTCTGGTTCTTTGGG + Intronic
1079749363 11:24177746-24177768 TTTGCTGGGTACAGTACTGTTGG + Intergenic
1086240205 11:84681423-84681445 CTAGCTGGTTGAGGCACTGTTGG + Intronic
1088679151 11:112224478-112224500 CATGCTGTTTTTGTTACTGTAGG - Intronic
1091907785 12:4202708-4202730 CTTGCTGGTTATGTGACCTTGGG - Intergenic
1092960585 12:13593304-13593326 CATGCTGTTTTTGTTACTGTAGG - Intronic
1093402704 12:18765613-18765635 CATGCTGTTTTTGTTACTGTAGG - Intergenic
1094096870 12:26715500-26715522 CTTTCTGGTTTTGCTACTCTGGG + Intronic
1098983263 12:76983104-76983126 TTTGCTGATTATGGTATTTTTGG + Intergenic
1099524212 12:83699125-83699147 CTTGCTGTTTTTGTTACTGTAGG - Intergenic
1100557412 12:95709678-95709700 ATAGCTGGGTATGGTGCTGTAGG - Intronic
1101463436 12:104921524-104921546 TTTGCTGGTTATAGTATTCTTGG - Intronic
1103138950 12:118532172-118532194 CTGGCAGGGGATGGTACTGTGGG - Intergenic
1104150910 12:126082211-126082233 CATGCTGTTTTTGTTACTGTAGG - Intergenic
1104825411 12:131704714-131704736 TTTGCTGGATATAGTATTGTTGG - Intergenic
1109411494 13:61975086-61975108 CTTTCTAGTTATGTAACTGTGGG + Intergenic
1110906315 13:80895180-80895202 TTTGTTGATTATGGTATTGTAGG + Intergenic
1110936471 13:81296316-81296338 CTTTCAGGTTATAGTACTGCTGG - Intergenic
1112671889 13:101650101-101650123 CTTAATGCTCATGGTACTGTTGG + Intronic
1112703663 13:102040996-102041018 CCTGCTGGGTATGGTAGGGTGGG - Intronic
1112736480 13:102425969-102425991 CTTGATGGTGATGATAATGTTGG + Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1118254383 14:64192726-64192748 CATGCTGGCTATGTAACTGTGGG - Intronic
1120212295 14:81645190-81645212 CTTGTTGCTTTTGGTACTGCAGG + Intergenic
1120261714 14:82193664-82193686 GTGGCTGGTTATGGAAATGTGGG + Intergenic
1121502745 14:94451292-94451314 TTTGCTGGTCAAAGTACTGTGGG + Intronic
1122011762 14:98755644-98755666 TTTGCTGGGTATAATACTGTTGG - Intergenic
1122480977 14:102047093-102047115 CTTGCTGGTGCTGGGACTGTGGG + Intronic
1130786773 15:87106093-87106115 CTTGCTGGGTATAGTATTTTTGG - Intergenic
1131191436 15:90319956-90319978 CTTGATTGTTATGGTACAGCTGG - Intergenic
1131517823 15:93090768-93090790 CATGATGCTTATGGTACGGTGGG - Intergenic
1131568672 15:93509296-93509318 CATGCTGGTTTGGTTACTGTAGG + Intergenic
1133511110 16:6458272-6458294 CCTGCTGGTTAAGGATCTGTGGG + Intronic
1134589080 16:15437289-15437311 CTTGCTGGCTATGTGACTTTAGG + Intronic
1135924294 16:26678830-26678852 CTTGCTGGTTATGAAATTCTTGG + Intergenic
1137887397 16:52120198-52120220 TTTGCTGGGTATAGTACTCTTGG - Intergenic
1138120197 16:54395091-54395113 TTTGCTGGTTATAGTATTCTAGG - Intergenic
1138401624 16:56749777-56749799 CTAGTTGGTTTTGGTTCTGTTGG + Intronic
1144035600 17:11362597-11362619 CTTGCTGCTTATATTACTGGCGG + Intronic
1146608270 17:34281789-34281811 CTTGCTGTTTTTGTTATTGTAGG - Intergenic
1147320568 17:39643384-39643406 CTTCCTGGCTAGGGGACTGTGGG + Intronic
1149254798 17:54813944-54813966 CTTGATGGTGATGGTTGTGTGGG + Intergenic
1149505091 17:57187683-57187705 TTTGGTTGTTATGGTAATGTTGG + Intergenic
1157018677 18:43752049-43752071 TTTGCTGGTTATAGTATTCTGGG - Intergenic
1157019841 18:43767422-43767444 CATGCTGTTTTTGTTACTGTAGG + Intergenic
1157783330 18:50459436-50459458 ATGGCTGGGTATGGTCCTGTTGG + Intergenic
1158169521 18:54581438-54581460 CCTGCTGGTTATAGTACAGTAGG - Intergenic
1158691497 18:59665290-59665312 TTTACTGGTTATGGTACAGAAGG + Intronic
1158735795 18:60077190-60077212 TTTGCTGGTTATGGTATCCTTGG - Intergenic
1159417261 18:68168929-68168951 CTTGCTGTTTTGGTTACTGTAGG + Intergenic
1159759779 18:72409626-72409648 CTAGCTGGGCATGGTGCTGTGGG + Intergenic
1161173727 19:2827237-2827259 CTTGCAAGTTATGGGACTGCAGG - Intronic
1161557045 19:4949691-4949713 TTAGCTGGTTATGGTCGTGTGGG + Intronic
1166895719 19:46020884-46020906 CTGGCTGGTTATGGCCCTGCTGG + Intronic
925075024 2:1009234-1009256 CATGCTGGTTCTGATACTGGTGG + Intronic
925075046 2:1009359-1009381 CATGCTGGTTCTGATACTGGTGG + Intronic
925075057 2:1009421-1009443 CATGCTGGTTCTGATACTGGTGG + Intronic
925075068 2:1009483-1009505 CATGCTGGTTCTGATACTGGTGG + Intronic
928032473 2:27793419-27793441 CTTATTGGTGATGCTACTGTTGG - Intronic
931242818 2:60467782-60467804 GTTGATGGTGATGGTACTGGTGG + Intronic
931966394 2:67540717-67540739 CTAGCTGGGCATGGTAGTGTGGG - Intergenic
935034759 2:99358783-99358805 CATTCTGGATTTGGTACTGTAGG + Intronic
936852507 2:116917828-116917850 CTCTCTGGTTATGGGACTGGAGG + Intergenic
937631941 2:124111372-124111394 CTTTCTGGCTATGATACGGTGGG + Intronic
940253644 2:151706682-151706704 CTTACTGTTTGTGGTTCTGTGGG - Intronic
942412174 2:175721324-175721346 CATGCTGTTTTTGTTACTGTAGG - Intergenic
942911091 2:181245230-181245252 CTTGCTGGATGTGGTTGTGTAGG + Intergenic
943126655 2:183802654-183802676 CTTGCTGGGTATAGGATTGTTGG + Intergenic
946152877 2:217788049-217788071 CTGGCTGTCTATGATACTGTTGG - Intergenic
946807494 2:223485790-223485812 CTTGCTGGTTATGCTATTGCAGG + Intergenic
948855019 2:240726069-240726091 CTTGCTGGTCATAGTAGTGAGGG - Intronic
1169881874 20:10355619-10355641 GTTGCTGATTATGGTGCTGGTGG - Intergenic
1170527441 20:17253868-17253890 CTTGCTGGTTTGGGTGCAGTTGG + Intronic
1171150349 20:22822123-22822145 CCTCCTGGTTCTGGTACTGTGGG - Intergenic
1172105786 20:32516696-32516718 CTTGCTTGCTGTGGGACTGTGGG - Intronic
1172306686 20:33885594-33885616 CTTGCTGCCTCTGGAACTGTGGG + Intergenic
1173725184 20:45292483-45292505 CGTACTGGTTATGTTACTGTTGG + Intergenic
1177888161 21:26771154-26771176 TTTGCTTTTTAAGGTACTGTTGG + Intergenic
1182672987 22:32013365-32013387 TTTGCTGGGTATGGTATTCTTGG + Intergenic
949313038 3:2721531-2721553 CTTCCTGCATATGGTACTGAAGG + Intronic
950130557 3:10542602-10542624 TTTGCTGGATATGGGACTCTGGG + Intronic
951341831 3:21497977-21497999 CTTGCTGTTTTGGTTACTGTAGG - Intronic
953664113 3:44913857-44913879 CTGGCTGCTTATGGTTGTGTTGG - Exonic
954110830 3:48431849-48431871 CTTCCTGGTTCTAGTACTGGAGG - Intergenic
955210065 3:56932774-56932796 AATGCTGGTGAGGGTACTGTAGG - Intronic
955813168 3:62813224-62813246 CATGCTGTTTAGGTTACTGTGGG - Intronic
956919295 3:73909337-73909359 GTTGCTGGTCATGGTGGTGTTGG + Intergenic
957648931 3:82973954-82973976 CATGCTTGTCATGGTACTCTTGG + Intergenic
960019581 3:112933295-112933317 CTTGCTGGGTTTGGGACTATGGG - Intronic
960753785 3:120985146-120985168 CTTTGTTGTTAGGGTACTGTTGG + Intronic
961162807 3:124743928-124743950 CTTGTGGGCTATTGTACTGTTGG - Exonic
962290361 3:134131216-134131238 CTTGCTGGTTTTGCGACTTTTGG - Intronic
963227417 3:142876517-142876539 CTTATTTGTTATGGTTCTGTGGG + Intronic
966900835 3:184482951-184482973 CTTACAGGTAATGGTACTGGGGG + Intronic
970338266 4:15076059-15076081 TTTGCTGGTTATAGTATTCTTGG - Intergenic
971749303 4:30625560-30625582 CATGCTGTTTTTGTTACTGTAGG + Intergenic
972901019 4:43683264-43683286 ATTGCTGGTTATGCAACTGTAGG + Intergenic
974920353 4:68231340-68231362 GTTGCCAGTTATGATACTGTTGG + Exonic
976073638 4:81271977-81271999 ATTGCAGGTTGTGGTACTTTTGG - Intergenic
977219863 4:94325948-94325970 TTTGCTGGTTATAGTATTCTTGG + Intronic
978117770 4:105042643-105042665 TTTGCTGGGTATAGTACTATTGG - Intergenic
978390728 4:108222632-108222654 CCTGCTGGTTCTGGGTCTGTGGG - Intergenic
979502182 4:121453397-121453419 CTTCCTGATTATGGTAGTGAAGG - Intergenic
982848673 4:160282335-160282357 CATGCTGTTTTTGTTACTGTAGG - Intergenic
984897630 4:184555974-184555996 CATGCTGTTTTGGGTACTGTAGG - Intergenic
987626551 5:20408134-20408156 TTTGCTGGTTATGGGATTCTTGG - Intronic
988785205 5:34560297-34560319 TTTGCTGGTTATGGGACCTTGGG + Intergenic
992583551 5:78207842-78207864 CTTGCTGGTTATGGTACTGTTGG - Intronic
1001502784 5:172251648-172251670 TTTGCTGGTTATGGTATTCTTGG - Intronic
1001819109 5:174695928-174695950 GTTACTGGTCATGCTACTGTGGG + Intergenic
1005605248 6:27470691-27470713 GTTGCTGTTTTTGGTTCTGTTGG - Intronic
1009702130 6:67198157-67198179 TTTGCTGGTTATAGTAATGTGGG - Intergenic
1010333635 6:74654899-74654921 CATGCTGTTTAAGGGACTGTGGG - Intergenic
1010487102 6:76427932-76427954 CCTTGTGGTTGTGGTACTGTTGG + Intergenic
1010621050 6:78075457-78075479 CTTGCTTGTTATTTTACAGTTGG + Intergenic
1012521861 6:100130854-100130876 TTTGCTGGTTATAGTATTCTTGG + Intergenic
1013487662 6:110612936-110612958 CTACCTGGTTATGATACTGTGGG - Exonic
1017152021 6:151289205-151289227 CTGGCTGGTGTTGGTTCTGTCGG - Intronic
1018156164 6:160987163-160987185 CTTGCTGTTTCTGGTTCTCTAGG + Intergenic
1020181526 7:5926383-5926405 CTTGCTGGTGATGGTCTTGCTGG + Exonic
1020301407 7:6798506-6798528 CTTGCTGGTGATGGTCTTGCTGG - Exonic
1020954233 7:14719962-14719984 CTTGCTGGTTATGAAACTCTGGG - Intronic
1021371194 7:19849729-19849751 TTTGCTGGTTATGGAATTCTGGG - Intergenic
1023255009 7:38304625-38304647 CTTGCTCGTTCTGATATTGTGGG + Intergenic
1024126005 7:46295139-46295161 CTTGTTAGATATGGTACTGCTGG - Intergenic
1024662786 7:51514841-51514863 TTTGCTGGTTGTGGTGCTGCTGG + Intergenic
1029112316 7:98218998-98219020 CATGCTGTTTTTGTTACTGTAGG - Intronic
1030355021 7:108532004-108532026 TTTACTGGTTGTGATACTGTGGG + Intronic
1034711432 7:153194862-153194884 CTTCCTGGTTTTGGTATTCTAGG + Intergenic
1038923289 8:32109933-32109955 CTTTCTAGTTATGGCACTTTAGG + Intronic
1044730162 8:95223081-95223103 CTTCCTGGTGATGGTAGCGTTGG + Intergenic
1046332115 8:112731611-112731633 CTTTTTGTTTATAGTACTGTAGG + Intronic
1046891210 8:119422966-119422988 CTGGATGGTTTTGGTATTGTGGG - Exonic
1047447654 8:124933839-124933861 CTTGCTGGTTATCGGATTGTGGG + Intergenic
1047668866 8:127122806-127122828 CTTTCTGGTCGTGGTGCTGTGGG - Intergenic
1048329064 8:133460025-133460047 AATGCTGTTTATGGTCCTGTGGG - Intronic
1051488419 9:17634090-17634112 CTGGCTGGTTTTGGAACTTTGGG + Intronic
1052440931 9:28495598-28495620 CATGCTGTTTTTGTTACTGTAGG + Intronic
1052806045 9:33014271-33014293 CTTGCTGGTGGTGGTAGTGGTGG - Intronic
1058184476 9:101838545-101838567 CATGCTGTTTTTGTTACTGTAGG - Intergenic
1058503067 9:105641525-105641547 CCTACTGGTCATGGCACTGTTGG - Intergenic
1060375579 9:123113115-123113137 CTTCCTGGTCAAGGTACTTTTGG - Intronic
1185751779 X:2616297-2616319 TTTGCTGGTTATGTTATTATTGG + Intergenic
1189122596 X:38410744-38410766 GTTGCTGGTGCTGGAACTGTAGG + Intronic
1189853881 X:45203075-45203097 GTCTCTGGTTATGGTACTGAGGG + Intergenic
1190592781 X:52021816-52021838 CATGCTGTTTTGGGTACTGTAGG + Intergenic
1191091245 X:56624691-56624713 CTTGCTGTTTTGGTTACTGTAGG - Intergenic
1192279542 X:69670154-69670176 CTTGCTGGGTATAGTATTCTTGG + Intronic
1194001633 X:88436936-88436958 TTTGCTGGTTAGGTTTCTGTAGG - Intergenic
1195669673 X:107459105-107459127 CTTTCAGGTCATGGTACTGAAGG - Intergenic
1197009449 X:121543628-121543650 GATGCTGGTCATGATACTGTTGG - Intergenic
1198189932 X:134293259-134293281 CTTGCTGGGTAAGGTATTCTTGG + Intergenic
1201483115 Y:14462128-14462150 CTTGCTGATTTGGTTACTGTAGG - Intergenic