ID: 992586447

View in Genome Browser
Species Human (GRCh38)
Location 5:78245032-78245054
Sequence CCTATGGGTGGTTTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 4, 2: 22, 3: 33, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992586447_992586458 4 Left 992586447 5:78245032-78245054 CCAGCCTCAAAACCACCCATAGG 0: 1
1: 4
2: 22
3: 33
4: 150
Right 992586458 5:78245059-78245081 CCAAAGTCCGGTGGCAACAAAGG 0: 2
1: 4
2: 13
3: 21
4: 110
992586447_992586453 -8 Left 992586447 5:78245032-78245054 CCAGCCTCAAAACCACCCATAGG 0: 1
1: 4
2: 22
3: 33
4: 150
Right 992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG 0: 2
1: 10
2: 11
3: 14
4: 108
992586447_992586455 -5 Left 992586447 5:78245032-78245054 CCAGCCTCAAAACCACCCATAGG 0: 1
1: 4
2: 22
3: 33
4: 150
Right 992586455 5:78245050-78245072 ATAGGGTACCCAAAGTCCGGTGG 0: 1
1: 12
2: 14
3: 17
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992586447 Original CRISPR CCTATGGGTGGTTTTGAGGC TGG (reversed) Intronic
900619845 1:3581701-3581723 CCTAGGGGTGGTCTCCAGGCCGG - Intronic
901096123 1:6681749-6681771 CCTCTTGGTGGCTGTGAGGCAGG - Intronic
902362395 1:15949342-15949364 ACTCTGGGTGGTGTTGGGGCGGG - Intronic
902956985 1:19932169-19932191 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
904242415 1:29156740-29156762 CCTACGGGTGGTGTTGAGGCTGG - Intronic
904415578 1:30359297-30359319 CCACAGGGTGGTTGTGAGGCTGG - Intergenic
905417307 1:37812810-37812832 CCCATGGGAAGTTTTGAGGTAGG - Exonic
913374489 1:118135517-118135539 CCTAGGGGTGATTTTGAGAGTGG - Intronic
915409817 1:155691838-155691860 CCTACGGGTGGTGCTGAGACTGG - Intronic
915410621 1:155698987-155699009 CCTACGGATGGTGTTGAGGCTGG - Intronic
916364420 1:164008325-164008347 CCTGAGGGTGGTATGGAGGCAGG + Intergenic
919051108 1:192512572-192512594 CCTGTGGGTGGTTCTGGGGTGGG - Intergenic
921228511 1:213045124-213045146 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1065858572 10:29850930-29850952 CCTCTGGGTGATTTTGGTGCTGG + Intergenic
1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG + Intergenic
1067102685 10:43344276-43344298 CCTATGGGTGGTTTTTCCTCTGG + Intergenic
1067279055 10:44857628-44857650 CCTATTGGTGCATTTGAGGGGGG + Intergenic
1068101178 10:52555067-52555089 CCCTTGGGTGAATTTGAGGCTGG + Intergenic
1070545676 10:77450686-77450708 TCTTTGGGTGGGTCTGAGGCTGG - Intronic
1073192593 10:101662363-101662385 CCTCTGGGGGGTTTTGATGGAGG - Intronic
1073457780 10:103647930-103647952 CCTAGGGGTGGGTTGGAGCCCGG + Intronic
1075098252 10:119487843-119487865 CCTTTGGGAGGTCATGAGGCTGG + Intergenic
1076171359 10:128322898-128322920 CCTAAGTGTGGGTTTGTGGCTGG + Intergenic
1077078990 11:714870-714892 CCTATGGCAGGTTGTGTGGCAGG + Intronic
1078296747 11:10078622-10078644 CCTATCGGGGGTTTGGGGGCTGG + Intronic
1078527347 11:12110855-12110877 CCGCCGGGTGGGTTTGAGGCGGG - Intronic
1079325313 11:19486200-19486222 GCTGTGGGTGGAATTGAGGCTGG + Intronic
1081508902 11:43747943-43747965 CCTGCGGGTGGTGTTGAGGCTGG + Intronic
1083057896 11:59840628-59840650 ACTATGGGTTTTTGTGAGGCTGG + Intronic
1083425350 11:62581553-62581575 CCTTTGGGGGATTTGGAGGCCGG + Exonic
1090403739 11:126465222-126465244 TTTATGGGAGGTTTTGAGGGAGG - Intronic
1090863206 11:130672836-130672858 TCTATGGGTGGGTTTAAGGGTGG - Intergenic
1092258080 12:6937733-6937755 TGCAGGGGTGGTTTTGAGGCGGG + Intronic
1092871554 12:12810298-12810320 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1094596688 12:31872624-31872646 ACTATGGGAGGTTATGGGGCTGG + Intergenic
1094653316 12:32398781-32398803 CCTTTTGGTTGTTTTGAGACAGG - Intergenic
1096212742 12:49778925-49778947 CCTATTGTTGTTTTTGAGACAGG + Intergenic
1097899760 12:64860660-64860682 CCCATGGGTGGTTCTGATACAGG + Intronic
1105039347 12:132949539-132949561 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1107149009 13:37090747-37090769 CCTATGGGTGGTGATGAGGCTGG + Intergenic
1113912897 13:113852702-113852724 CCTGTGGGTGGCTTTGAGCGGGG - Intronic
1120036807 14:79706993-79707015 CCTACGGGTGGTGCTGAGGCTGG + Intronic
1120599641 14:86485778-86485800 CCTATGAGTGGCTTTTAGGTAGG + Intergenic
1122853229 14:104547816-104547838 CTGATGGGTGGTCTGGAGGCTGG + Intronic
1123021959 14:105402880-105402902 CATATGTGTGTTTTTGAGACAGG + Intronic
1127735324 15:61834043-61834065 CCTATGGGTGGATTTGACTTTGG + Intergenic
1129844529 15:78762172-78762194 CCTATGGGATGTTGTGTGGCCGG + Intronic
1130214856 15:81958692-81958714 CCAAGGGGTGGTTTGGAGGAAGG - Intergenic
1130814676 15:87418845-87418867 CATATGGAGGGTTTTGAGCCTGG - Intergenic
1132299364 15:100766793-100766815 CCTCTGGGTGGTTTTGAGGTGGG - Intergenic
1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1139393851 16:66624112-66624134 CATATGGGTGGTTTGGACCCTGG - Intronic
1139965698 16:70744251-70744273 CCTCTGGGCGGTCTTGAGGTGGG + Intronic
1141721621 16:85759218-85759240 TCTATGTGTGTTTTTGAGACAGG - Intergenic
1143621446 17:8082817-8082839 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1146443033 17:32913703-32913725 CGTACGGGTGGTGTTGAGGCTGG + Intergenic
1146972414 17:37083592-37083614 CCTGTTGGTGGTTCTGAGGCAGG - Intergenic
1147547666 17:41415250-41415272 CCTCTGGGTGATTCTGATGCTGG - Intergenic
1147934573 17:44004510-44004532 CCTCTGGGTGCGTTTGAGGAGGG - Intergenic
1148468462 17:47878653-47878675 CCTGTCGGTGGCTTTGAGGCCGG + Intergenic
1150279396 17:63920316-63920338 ACTTTGGGTGGCTTTGAGGTGGG + Intergenic
1150571127 17:66388066-66388088 CCTATGTCTGGGCTTGAGGCAGG + Intronic
1154321682 18:13359181-13359203 ACTATAGGTGGCTCTGAGGCAGG + Intronic
1154379212 18:13834805-13834827 TCTATTCGTGGTTTTCAGGCAGG - Intergenic
1155450578 18:25958953-25958975 TGTTTGGGTGGTTTTGAGGCAGG - Intergenic
1156210112 18:34930386-34930408 ACTATGGTTGGTTAGGAGGCTGG - Intergenic
1159648159 18:70943786-70943808 AACATGGGTGGTTTTCAGGCAGG + Intergenic
1161178561 19:2863834-2863856 CCTACGGGTGATGTTAAGGCTGG + Intergenic
1161898542 19:7100439-7100461 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1162007960 19:7791846-7791868 CCTACGGGTAGTGTTGAGGCTGG - Intergenic
1162009141 19:7801056-7801078 CCCACGGGTAGTGTTGAGGCTGG - Intergenic
1164093946 19:21987989-21988011 CCTACAGGTGGTATTGAAGCTGG + Intronic
1164291827 19:23876587-23876609 CCCACAGGTGGTGTTGAGGCTGG - Intergenic
1165258604 19:34595175-34595197 CCTACGGGTAGTGTTGAGGCTGG - Exonic
1165556430 19:36636552-36636574 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1166424728 19:42667565-42667587 CCTACGGGTGGTGTTGAGGCTGG - Intronic
1166897214 19:46031436-46031458 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1167327774 19:48835950-48835972 CCTATGGGTGATCATGAGACTGG - Intronic
1167881332 19:52460876-52460898 AAAATGGGTGGTGTTGAGGCTGG - Intronic
1167881883 19:52465934-52465956 CCTAAGGGTGGTGTTGAGGCTGG - Intronic
926140467 2:10365049-10365071 ACTCTGGGAGATTTTGAGGCTGG - Intronic
927465078 2:23330731-23330753 CCAGTGGGTGGCTTTGGGGCGGG + Intergenic
928611927 2:32999586-32999608 CCTCTGGATCTTTTTGAGGCAGG - Intronic
929976066 2:46636209-46636231 CCTTAGGTTTGTTTTGAGGCAGG + Intergenic
930912327 2:56644122-56644144 CAGATGGCTGGGTTTGAGGCAGG - Intergenic
932811946 2:74833576-74833598 CCTATCAGTGGTTTTGAGGATGG + Intergenic
933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG + Intronic
937127224 2:119482364-119482386 CCTGTGGGGGCTTTGGAGGCGGG + Intronic
938115610 2:128601425-128601447 CCTGTGGGAGCTTTTGAGGAGGG + Intergenic
940476562 2:154169513-154169535 CCTATGGAGGGTTTTGAGAATGG + Intronic
944174453 2:196814415-196814437 CCTATAGGGGGTTGAGAGGCTGG + Intergenic
945421164 2:209638457-209638479 TCTAGGGGTGGATTTGGGGCAGG - Intronic
946320176 2:218948989-218949011 CCTGTTGTTGTTTTTGAGGCAGG - Intergenic
948537905 2:238659747-238659769 CCTGTGGGAGATGTTGAGGCTGG + Intergenic
948822381 2:240556716-240556738 TCTACGGGTGGTGTTGAGGCTGG + Intronic
1170129296 20:13001448-13001470 CCTATGGGAGGGTTATAGGCTGG - Intergenic
1172535256 20:35667745-35667767 CCTATTGTTGTTTTTGAGACAGG + Intronic
1172807938 20:37626353-37626375 CCTATAGATGGTTCTGAAGCTGG + Intergenic
1173427678 20:42956960-42956982 CCAATGGGTGGTTTAGATCCAGG - Intronic
1176193908 20:63828080-63828102 CCTAAAAGTGGTTCTGAGGCTGG - Intronic
1179717913 21:43299482-43299504 CCTGTGCCTGGTTCTGAGGCTGG - Intergenic
1179780710 21:43699042-43699064 GCTGTGGGTGGTGTTGAGGCTGG + Intergenic
1179787720 21:43739386-43739408 ACCATGGGTGGTGTTGAGGCTGG + Intronic
1181049324 22:20231218-20231240 CCCATGGAGGGTTTGGAGGCTGG + Intergenic
1181710845 22:24687085-24687107 CTTATGGTTGGTGATGAGGCAGG + Intergenic
1182249421 22:28988327-28988349 ACAAGGGGTGGTTTTGAAGCAGG + Intronic
1183881031 22:40829958-40829980 CCTATGGGTGTTTTAAAGCCAGG - Intronic
1184548339 22:45189254-45189276 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1184807151 22:46802630-46802652 CCTCTGGGAGGTTTTGAACCGGG + Intronic
1185401783 22:50622680-50622702 CCTATGAATGGTTGTGTGGCGGG - Intergenic
952620709 3:35337909-35337931 CCTTTGAGTAGTTTTGAGGTTGG - Intergenic
955351417 3:58196236-58196258 CCTCTTGGAGCTTTTGAGGCTGG - Intronic
955419801 3:58724808-58724830 CGGGTGGGTGGTGTTGAGGCTGG + Intronic
959012114 3:101089627-101089649 CCTACGGGTGGTATTAAGGCTGG + Intergenic
959773219 3:110125105-110125127 GCCATGGGTGGTTTTGAAACAGG - Intergenic
961638907 3:128352537-128352559 CCTCTGTCTGGTTCTGAGGCCGG + Intronic
961712032 3:128835142-128835164 CCTGTGGGTGGTGTTGAGGCTGG + Intergenic
966666130 3:182472936-182472958 CCCATTGCTGGTTTTGAGGATGG - Intergenic
967997771 3:195179846-195179868 CCTAAGTGTGGTGTTGAGCCAGG + Intronic
969363941 4:6683056-6683078 GCTGTGGGTGGTATGGAGGCAGG - Intergenic
969647642 4:8441738-8441760 CCTACGGGTGGTGTTGAGGCTGG - Intronic
969944315 4:10767361-10767383 ACTAGAGGTAGTTTTGAGGCAGG + Intergenic
971137745 4:23888465-23888487 CCTGTGGGTGGTTGTCTGGCTGG - Intronic
973308752 4:48683613-48683635 CCTATGGGAGTTCTTGAGACAGG - Intronic
973620681 4:52722505-52722527 CCTAGGGGTGGGCTTGAGGCCGG - Intergenic
974471385 4:62323150-62323172 CCTCTGGGAGATTTTGACGCAGG + Intergenic
976148592 4:82069036-82069058 CCTAGGAATGGTTTTGATGCTGG - Intergenic
977741659 4:100491493-100491515 CCTATGGGGAGCCTTGAGGCAGG - Intronic
979121368 4:116906112-116906134 ACTATGGATAGTTTTGTGGCTGG - Intergenic
981114238 4:140971243-140971265 TCTGTGGGTGGGTGTGAGGCAGG + Intronic
981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
984860288 4:184231615-184231637 TCTGTGTGTGGTTGTGAGGCTGG + Intergenic
985430115 4:189871101-189871123 TTTCTGGGTGGCTTTGAGGCTGG + Intergenic
985747809 5:1656996-1657018 CCTATGGGGGGTCATGAGGGTGG + Intergenic
985908766 5:2863236-2863258 GCTGTGGCTGGTTTTGTGGCTGG - Intergenic
986234596 5:5895327-5895349 CCTATAGGTGCTTTTAAGGTGGG - Intergenic
991479309 5:67059998-67060020 CCCATGGGTGGTTGTGGGGTGGG - Intronic
992464628 5:76991611-76991633 CTTTAGGGTGGTTTTTAGGCCGG - Intergenic
992586447 5:78245032-78245054 CCTATGGGTGGTTTTGAGGCTGG - Intronic
994331102 5:98507568-98507590 CCTATTGGTGGTGTTGGGGGAGG + Intergenic
998433701 5:142088769-142088791 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1003495538 6:6660497-6660519 ACTGTGGGGGGCTTTGAGGCGGG + Intergenic
1004613810 6:17270546-17270568 ACTATGGGGAGTTTTGAAGCTGG - Intergenic
1005077832 6:21925994-21926016 CCTTTGTGTGGTTTTGGGGGGGG - Intergenic
1005575783 6:27188039-27188061 CCTAAGGGTGGTATTGAGGCTGG + Intergenic
1005576676 6:27196248-27196270 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1005721680 6:28608415-28608437 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1006150552 6:31984701-31984723 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006151109 6:31990514-31990536 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006156853 6:32017439-32017461 CCTACGGGTGGCGTTGAGGCTGG - Intronic
1006157410 6:32023252-32023274 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006223246 6:32513354-32513376 TCCACGGGTGGTGTTGAGGCTGG + Intergenic
1006453382 6:34118326-34118348 CCTATGGGTGCTTTGCAGGCTGG - Intronic
1012884117 6:104825151-104825173 CATTTGAGTGGTTTTGAGGCAGG + Intronic
1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG + Intergenic
1014526204 6:122504854-122504876 CCTACGGATGGTGTTGAGGCTGG - Intronic
1014712334 6:124821802-124821824 CCTATGGGATGTTTTGTGGAAGG - Intronic
1015435483 6:133181809-133181831 CCTTTGGGAGGTCTGGAGGCAGG + Intergenic
1016048658 6:139506533-139506555 CCCATGCGAGGTTCTGAGGCTGG - Intergenic
1017541100 6:155404258-155404280 CCTCTGGGTGGGTGTGAGGTGGG + Intronic
1018707562 6:166474129-166474151 CCTAGGGCTGGTTGTGAGGGTGG + Intronic
1019686363 7:2384252-2384274 CAGCTGGGTGGGTTTGAGGCCGG + Intergenic
1022216289 7:28265539-28265561 CCTGAGGGTGATTCTGAGGCAGG - Intergenic
1023036810 7:36138351-36138373 CCTATTCGTGGTTTTCAGACAGG + Intergenic
1025194875 7:56924957-56924979 CCTGTGTGTGGTTCTGAGGAGGG + Intergenic
1025677077 7:63651986-63652008 CCTGTGTGTGGTTCTGAGGAGGG - Intergenic
1026028107 7:66763443-66763465 ACTATTGATGGTTTTGAAGCTGG - Intronic
1029673154 7:102047893-102047915 CCTGTGTGTGGTTCTGAGGAGGG + Intronic
1029680165 7:102102961-102102983 CCTGTGGGTGGCTCTGGGGCAGG - Intronic
1033194815 7:139318883-139318905 CCTGTGGGTGGTTCTCCGGCTGG + Intergenic
1033206799 7:139429975-139429997 CATATGGGTGTTTTTAAGGCAGG + Intergenic
1034653540 7:152711518-152711540 TCTAAGGTTGATTTTGAGGCAGG + Intergenic
1034905043 7:154936784-154936806 CCCGTGGGTGGCGTTGAGGCTGG - Intronic
1035556975 8:574626-574648 CCCATGGGTGGTGCAGAGGCAGG + Intergenic
1037945164 8:22985099-22985121 CCTATGGGTGGTGTTGAGACTGG - Intronic
1040293516 8:46137528-46137550 ACTAAGGGGGATTTTGAGGCAGG - Intergenic
1040333250 8:46403109-46403131 ACTAAGGGTGATGTTGAGGCAGG + Intergenic
1040348351 8:46534223-46534245 CCTACAGGTGGTGTTGAGGCTGG + Intergenic
1040584682 8:48727682-48727704 CCTCTGGGGGGTTTTGAGCATGG + Intronic
1041457096 8:58072949-58072971 TCTATAGGTGGATTTGTGGCTGG + Intronic
1042039560 8:64577766-64577788 CCTATCGGTTGTTATAAGGCCGG + Intergenic
1043622100 8:82206745-82206767 CCTACGGGTGGTGTTGAGGCTGG + Intergenic
1044057445 8:87588719-87588741 CCTATGGTTGGCTTTGAAGGTGG - Intronic
1045652208 8:104351901-104351923 GCTGTTGGTGTTTTTGAGGCAGG - Intronic
1047741350 8:127809493-127809515 TCTATGGAAGGTTTTGAGGTGGG + Intergenic
1048993258 8:139773695-139773717 CTGATGGGTGGTTTTGCTGCCGG - Intronic
1049026614 8:139995372-139995394 CCTGTGGTTTGCTTTGAGGCTGG - Intronic
1049708724 8:144054332-144054354 CCGAGGGGTGGTTTTGCGGGTGG - Intronic
1052824350 9:33164246-33164268 CTTGCGGGTGGTTTTGAGGTTGG - Intronic
1052993970 9:34539831-34539853 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1054820041 9:69513285-69513307 CCTATGGTAGGGTTAGAGGCTGG - Intronic
1056593403 9:87984155-87984177 CCTACGGGTGGTGTTGGGGTTGG - Intergenic
1056751258 9:89353116-89353138 CCTCTGGGTGATTCTGATGCTGG - Intronic
1057116047 9:92523413-92523435 CCTATGGGTGGTGTTGAGGCTGG - Intronic
1057528747 9:95825416-95825438 CCCCTGGGTGGTGTTGGGGCAGG + Intergenic
1058031322 9:100201169-100201191 CATAAGGGTGGTATGGAGGCAGG + Intronic
1058342064 9:103910056-103910078 CTTGTGGGTGGGTTTCAGGCAGG - Intergenic
1058857045 9:109072601-109072623 CCTACGGGTGGTGTTGAGGCTGG + Intronic
1060916257 9:127392792-127392814 CCCATGGGAGGGTTTTAGGCAGG + Intronic
1061194763 9:129101803-129101825 CCTACAGGTGGAGTTGAGGCTGG + Intronic
1187532745 X:20111578-20111600 CAGATGGGTAGTTGTGAGGCCGG + Intronic
1189056017 X:37700357-37700379 TCTATGGGAATTTTTGAGGCTGG - Intronic
1190336086 X:49262745-49262767 CCTATGTGTGATTTTTAGCCAGG - Intronic
1190556063 X:51637031-51637053 CCTACTGGTGGTGTTGAGGCTGG + Intergenic
1195295211 X:103469881-103469903 CCTACGGGTGGTGTTGAGGCTGG - Intergenic
1198712302 X:139518272-139518294 CCTATGGGTGGTGTTGAGGCTGG + Intergenic
1200018676 X:153183959-153183981 CCTATGGGTGGGTATGAGTCTGG - Intergenic
1201377090 Y:13334271-13334293 CCCACGGGTGGTGATGAGGCTGG + Intronic
1201668936 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG + Intergenic