ID: 992586453 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:78245047-78245069 |
Sequence | CCCATAGGGTACCCAAAGTC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 145 | |||
Summary | {0: 2, 1: 10, 2: 11, 3: 14, 4: 108} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
992586447_992586453 | -8 | Left | 992586447 | 5:78245032-78245054 | CCAGCCTCAAAACCACCCATAGG | No data | ||
Right | 992586453 | 5:78245047-78245069 | CCCATAGGGTACCCAAAGTCCGG | 0: 2 1: 10 2: 11 3: 14 4: 108 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
992586453 | Original CRISPR | CCCATAGGGTACCCAAAGTC CGG | Intronic | ||