ID: 992586453

View in Genome Browser
Species Human (GRCh38)
Location 5:78245047-78245069
Sequence CCCATAGGGTACCCAAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 2, 1: 10, 2: 11, 3: 14, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992586447_992586453 -8 Left 992586447 5:78245032-78245054 CCAGCCTCAAAACCACCCATAGG No data
Right 992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG 0: 2
1: 10
2: 11
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992586453 Original CRISPR CCCATAGGGTACCCAAAGTC CGG Intronic