ID: 992586453

View in Genome Browser
Species Human (GRCh38)
Location 5:78245047-78245069
Sequence CCCATAGGGTACCCAAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 2, 1: 10, 2: 11, 3: 14, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992586447_992586453 -8 Left 992586447 5:78245032-78245054 CCAGCCTCAAAACCACCCATAGG 0: 1
1: 4
2: 22
3: 33
4: 150
Right 992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG 0: 2
1: 10
2: 11
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992586453 Original CRISPR CCCATAGGGTACCCAAAGTC CGG Intronic
900398678 1:2463894-2463916 CCCATGGGGCACACAGAGTCGGG + Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904031001 1:27533372-27533394 CCCAAGAGGTCCCCAAAGTCAGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
912948513 1:114104597-114104619 CCCATAGGGCTTCCAGAGTCAGG + Intronic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
922398324 1:225225505-225225527 CCCATATAGTACCCAAGGACAGG + Intronic
1066021246 10:31304799-31304821 CCCATGACATACCCAAAGTCTGG + Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1073043119 10:100620842-100620864 GCAACAGGGTACCCCAAGTCTGG - Intergenic
1073650246 10:105351287-105351309 CTCATAGGGTTCCCCAAGTTAGG + Intergenic
1074199876 10:111225229-111225251 GCTATAGGGTTCCCAAAGTGGGG + Intergenic
1076543256 10:131227601-131227623 CCCATAGAGAACCCAGGGTCGGG - Intronic
1077670388 11:4151902-4151924 CTTAGGGGGTACCCAAAGTCAGG + Intergenic
1078538860 11:12197604-12197626 CACATAGGTTCCCCGAAGTCAGG - Intronic
1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG + Intronic
1089808666 11:121114335-121114357 CACATTGGGCACCCAAAGTTTGG + Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1095903357 12:47351718-47351740 CCCATCTGTTATCCAAAGTCTGG + Intergenic
1097189710 12:57213632-57213654 CCCAGAGGGAACACAAAATCTGG - Intergenic
1098665499 12:73157385-73157407 CCCATAAAGTACCAAAAGTATGG + Intergenic
1100382083 12:94071523-94071545 CTCATAGGGTTCACAATGTCAGG + Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1111213473 13:85111082-85111104 CCCCTACTTTACCCAAAGTCGGG + Intergenic
1117442115 14:55769750-55769772 CCCATAGAGTACCCTTAGACTGG - Intergenic
1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG + Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1129691748 15:77717794-77717816 CCCATTGGATACCTACAGTCTGG + Intronic
1130856177 15:87841668-87841690 ACCAAAGGGCACCCACAGTCTGG + Intergenic
1132852808 16:2032569-2032591 CCCAGGGGGCACCCAAAGTTGGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1134235146 16:12459439-12459461 CCCATAGGGAGCCCAGAGACAGG + Intronic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1138127692 16:54452391-54452413 CCCACATGGTGCCCAAAGCCTGG - Intergenic
1142479746 17:211747-211769 CCCCAAGGGTAGCCAAAGGCTGG - Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1143877536 17:10003455-10003477 CCCATGGGGTCCCCACAATCTGG + Intronic
1144359180 17:14475533-14475555 CCCCCAGGGTCCCCATAGTCTGG + Intergenic
1144958087 17:19029688-19029710 CCCAGAGGGTAGCCCCAGTCTGG - Intronic
1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG + Intronic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1153789369 18:8563945-8563967 GTCAGAGGGTGCCCAAAGTCAGG + Intergenic
1154485507 18:14868608-14868630 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1155271227 18:24143131-24143153 GCCATAGGGTACGACAAGTCTGG - Exonic
1157350039 18:46875930-46875952 CCCATAGGGTGCCGAACTTCAGG - Intronic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1164093941 19:21987974-21987996 CCTGTAGGGTACAGAAAGTCCGG - Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165431666 19:35776442-35776464 CCCATAAGGTTCCCCAAGGCAGG - Intronic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1168689184 19:58366686-58366708 CCAATAGGGTTCCCCAAGTGTGG - Intergenic
1168698427 19:58419782-58419804 CACGTAGGGTAACCAAAGTATGG + Intergenic
932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG + Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
937228824 2:120385006-120385028 ACCACAGGGTGCCCAAGGTCAGG - Intergenic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
943978682 2:194517171-194517193 GCCATTGGGTACCCAATGTTAGG - Intergenic
1169203711 20:3728757-3728779 CCCAAATGGCACCCAAAGCCAGG - Intergenic
1169790909 20:9409721-9409743 TCCAAAGTGTACTCAAAGTCAGG + Intronic
1170745808 20:19098049-19098071 CCCATAGGCTACACACAGACAGG + Intergenic
1172286436 20:33743897-33743919 CCCTTAGGGGACTCACAGTCTGG + Intronic
1175585143 20:60133113-60133135 CCCAGAGGACACCCAAAGCCTGG - Intergenic
1176795829 21:13370869-13370891 CCCAAAGGGTGCCCAGAGGCAGG + Intergenic
1179780706 21:43699027-43699049 CCCACAGCGTACCCGAAGTTCGG - Intergenic
1179787716 21:43739371-43739393 CCCATGGTGTATCCAACGTCCGG - Intronic
1180289510 22:10784099-10784121 CCCAAAGGGTGCCCAGAGGCAGG + Intergenic
1180305389 22:11068700-11068722 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
949669029 3:6377049-6377071 CCCATCGGCCTCCCAAAGTCCGG - Intergenic
949844216 3:8353555-8353577 CCAATATGGAACCCAAAGTGGGG - Intergenic
950721102 3:14883167-14883189 CCCATAGGTTACACAAACCCAGG - Intronic
950742752 3:15063364-15063386 CCCAGCAGGTACCCAAAGACTGG + Intronic
952889024 3:38029085-38029107 CCCAGAGGCTCCCCAAAGCCTGG - Intronic
954904515 3:54048754-54048776 GCCATAGGGTACGGCAAGTCTGG + Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
961712024 3:128835127-128835149 CCCACAGGGTACCCGAGGTCGGG - Intergenic
964172141 3:153783532-153783554 CCCATAGAATTCCCAAAGTAGGG - Intergenic
968838060 4:2980125-2980147 TCCACAGGGTACCCAGAGCCTGG + Intronic
969647648 4:8441753-8441775 CCCGTAGGGTACTCAAAGTCCGG + Intronic
976333391 4:83857484-83857506 CACCTAGGGTATCCAAAGTAGGG - Intergenic
977789691 4:101084923-101084945 CCCATCTGGTACCCAGAATCAGG + Intronic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
980175134 4:129335735-129335757 CACATAAAGTACCCAAAATCAGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
985796066 5:1963099-1963121 GCCATAGGGCACCCAAAATGTGG - Intergenic
988520176 5:31938546-31938568 CCCATTGGGGACCAAAACTCTGG + Intronic
992213697 5:74505559-74505581 CCCATGGCGTACTCAAATTCAGG + Intergenic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
1002724291 5:181284044-181284066 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1011492977 6:87911676-87911698 CCCAAAGAGTACCCAAATGCTGG + Intergenic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1015400039 6:132778302-132778324 TCCATAAGGTACCCAATGTCAGG - Intronic
1017191594 6:151659613-151659635 CCCAGACGGTACCCACAGTGAGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1030375092 7:108745274-108745296 CCCATAGGGTCTCCAGAGCCTGG + Intergenic
1034367168 7:150561096-150561118 ACCTGCGGGTACCCAAAGTCTGG + Intergenic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1049615601 8:143574575-143574597 CCCACAGCCTACCCAAAGCCGGG + Intergenic
1049831655 8:144704835-144704857 CCCACAGTGGACCCAAACTCCGG + Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1053886427 9:42647477-42647499 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1054225446 9:62454926-62454948 CCCAAAGGGTGCCCAGAGGCAGG - Intergenic
1056338839 9:85603677-85603699 CCCCTAGGGTCCCCAATTTCAGG + Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1203759663 EBV:5597-5619 CCCGTGGGGTGCCCAAAGGCGGG - Intergenic
1189429891 X:40937032-40937054 CACATAAGGTACACAAAGGCGGG + Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1190594930 X:52043013-52043035 CCCATATGGTACACAAAATGAGG - Intergenic
1190613894 X:52211060-52211082 CCCATATGGTACACAAAATGAGG + Intergenic
1190908796 X:54753650-54753672 CTCATAGAGGACCCAAAGGCAGG - Exonic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1196201554 X:112891580-112891602 ACCAAAGTGTACCCAAACTCAGG + Intergenic
1196313945 X:114200836-114200858 CCCCTAAGGCACCAAAAGTCAGG + Intergenic
1196320200 X:114278536-114278558 CCTATAGAGTAGGCAAAGTCTGG - Intergenic
1199284798 X:146043695-146043717 ACCATAGGGTGCCCAAAGGAAGG + Intergenic
1200372937 X:155746690-155746712 CACATTGGGTACTCAAATTCTGG + Intergenic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic