ID: 992596153

View in Genome Browser
Species Human (GRCh38)
Location 5:78349255-78349277
Sequence CTCTCTGTTCACATAAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992596149_992596153 20 Left 992596149 5:78349212-78349234 CCTGACATACGCCAGGGTGTTCA No data
Right 992596153 5:78349255-78349277 CTCTCTGTTCACATAAGGCAGGG No data
992596150_992596153 9 Left 992596150 5:78349223-78349245 CCAGGGTGTTCAAGAAATTTCAG No data
Right 992596153 5:78349255-78349277 CTCTCTGTTCACATAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992596153 Original CRISPR CTCTCTGTTCACATAAGGCA GGG Intergenic
No off target data available for this crispr