ID: 992603247

View in Genome Browser
Species Human (GRCh38)
Location 5:78426679-78426701
Sequence CAGGGAAATTTTGGGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 1, 2: 6, 3: 44, 4: 435}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992603247_992603254 21 Left 992603247 5:78426679-78426701 CCATCCTTCCCAAAATTTCCCTG 0: 1
1: 1
2: 6
3: 44
4: 435
Right 992603254 5:78426723-78426745 CATTCCTTTCCCCTAGCTCCAGG 0: 1
1: 1
2: 7
3: 82
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992603247 Original CRISPR CAGGGAAATTTTGGGAAGGA TGG (reversed) Intronic
900670030 1:3846352-3846374 CAGGCACATTTGGGGCAGGAGGG + Intronic
900670372 1:3849630-3849652 CAGGCACATTTGGGGCAGGAGGG + Intronic
902052790 1:13577363-13577385 CAGGGACAGTCTGGGAAGGCAGG - Intergenic
902230070 1:15022191-15022213 CAGGGAAGTGATGGGAGGGAGGG - Intronic
902864664 1:19270213-19270235 CAGGGGAAGGTAGGGAAGGAAGG + Intergenic
902866887 1:19285649-19285671 CAGGGGAAGGTAGGGAAGGAAGG + Intronic
904485731 1:30823620-30823642 CAGGGAAGCTTTGTGGAGGAGGG - Intergenic
904933704 1:34111321-34111343 CAATGAAAATCTGGGAAGGAAGG + Intronic
905159963 1:36023849-36023871 AAGGCAAATTTTGGAAAGTAAGG - Intronic
906041032 1:42787944-42787966 CAGGGAAATCTGGGAAGGGAAGG - Intronic
906816993 1:48889384-48889406 TAGGGAAATGTTGGAAGGGAGGG + Intronic
908065515 1:60399522-60399544 CAAGGAAAATTTGGGAGTGATGG + Intergenic
908650316 1:66325792-66325814 CAGAGAAGTGGTGGGAAGGAGGG + Intronic
908964140 1:69737624-69737646 CAAGGAAATTCTGGGAAAGCAGG - Intronic
909606427 1:77513204-77513226 CAAGGAAAGTGTGGGAAAGATGG - Intronic
909899666 1:81116631-81116653 CAGGAAACTTTTGAGAATGATGG - Intergenic
910118144 1:83755428-83755450 CAGTGAAAGTTAGGGAAGTATGG + Intergenic
910733842 1:90429586-90429608 CAGGGATATTTTGGGGATAATGG - Intergenic
910768274 1:90804543-90804565 CAGTGCAATGTTGGGAAGCAGGG + Intergenic
911068389 1:93812489-93812511 CAGGGAAATGGTGGGCAGAAAGG - Intronic
911475096 1:98364488-98364510 TAGGGAGATTTTTGGAAGAAAGG + Intergenic
911735296 1:101330466-101330488 CAGGTAAATTCTCTGAAGGAAGG + Intergenic
911797955 1:102097859-102097881 CAGGGAAATTGAGGTAAAGAAGG - Intergenic
913496568 1:119433263-119433285 CAGGGCAATTTTCACAAGGAAGG + Intergenic
914216669 1:145636935-145636957 AGGGGAAATTTTGGAAATGAGGG + Intronic
914351510 1:146843945-146843967 CAGGAATATTTAAGGAAGGATGG - Intergenic
914469237 1:147959618-147959640 AGGGGAAATTTTGGAAATGAGGG + Intronic
915047485 1:153030572-153030594 CAGTGAAACTCTGGGAAGAATGG - Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915942407 1:160127066-160127088 CAGGGGTCTTCTGGGAAGGAAGG - Intronic
916766971 1:167870488-167870510 CAAGGATATTTTTAGAAGGAGGG - Intronic
919539759 1:198831671-198831693 AAGGGAAGTGCTGGGAAGGAAGG - Intergenic
919753484 1:201052745-201052767 AAGGGAATTTTGGGGAAGTAGGG - Intronic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920211302 1:204330803-204330825 CAGGGTGATCTAGGGAAGGAGGG - Intronic
921734720 1:218613861-218613883 CTAGGAAATTTGGGTAAGGATGG - Intergenic
922505801 1:226124822-226124844 CAGGGACCTTTAGGGAGGGATGG - Intergenic
923110202 1:230884119-230884141 CAGGGAAATAGTTGGAAGGGAGG + Intergenic
923584915 1:235259946-235259968 CAGGGAACTTTTAGGTGGGAAGG - Intronic
924020637 1:239777958-239777980 CGGGGAAAGGTTGGGAGGGAAGG + Intronic
924262424 1:242245902-242245924 GAGGGAAATGCTGTGAAGGAAGG - Intronic
924852049 1:247840352-247840374 TAATGAAATTGTGGGAAGGAAGG - Intergenic
1064511529 10:16099208-16099230 CAGGGATATTTTGGGGAACAGGG - Intergenic
1064962258 10:20978201-20978223 CAGGGAAGTGTTGGGGAAGATGG - Intronic
1065684278 10:28268322-28268344 CAGAGAAATTTTGATAAAGAAGG + Intronic
1065886286 10:30080413-30080435 CAGGAATATATTGGAAAGGATGG - Intronic
1066346315 10:34590386-34590408 AAGGGAAAAGTTGGGAAGTAGGG - Intronic
1066474609 10:35733255-35733277 AAGAGAAATTTTGGGAATAATGG - Intergenic
1068936993 10:62645721-62645743 CAGGGAAGTGATGGGATGGATGG + Intronic
1069146864 10:64903427-64903449 TAGTGAAAAATTGGGAAGGAAGG + Intergenic
1070519138 10:77236525-77236547 CAGGGAACTTTAAGGAAGGATGG - Intronic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1072048512 10:91680920-91680942 CAGGAAAACTTTGGGAATAAGGG + Intergenic
1072219033 10:93311971-93311993 CAAGGAAATTTTGGGGGTGATGG + Intronic
1072220763 10:93325826-93325848 CTGGGAAATGTTGGGCTGGAAGG + Exonic
1072774401 10:98175432-98175454 AAGGGAATTTTTTGGATGGATGG - Intronic
1072898204 10:99385351-99385373 AAGGGAAAGTAGGGGAAGGAAGG - Intronic
1073143124 10:101261937-101261959 CAGGGGGATTTTATGAAGGAAGG - Intergenic
1074500738 10:114021785-114021807 CAGGGTACTATTTGGAAGGAGGG - Intergenic
1074828130 10:117229152-117229174 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1074828586 10:117232280-117232302 CAGGGAATGCTGGGGAAGGAGGG + Intergenic
1074982011 10:118627265-118627287 CAGGGAAAACTTGGAAAGGCAGG + Intergenic
1075389916 10:122084609-122084631 CAGGGAAGGATTGGGAAGAATGG + Exonic
1075620212 10:123921958-123921980 CAGGGAAACATGGGGAGGGATGG - Intronic
1077150053 11:1068844-1068866 CAGGGATTTGTGGGGAAGGATGG + Intergenic
1078230076 11:9432883-9432905 CAGAGAAATTATCCGAAGGAAGG - Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078779050 11:14420033-14420055 GTGGGAAATTTTGGGAATTAAGG + Intergenic
1078944373 11:16047047-16047069 TGGGGAAATTATGGGGAGGAAGG + Intronic
1079023831 11:16930041-16930063 CTGGGATATTTTGGGGAGCAGGG + Intronic
1079817022 11:25074114-25074136 CAGAGAACTGTTGTGAAGGAAGG - Intronic
1080242641 11:30144251-30144273 CAGGGAAATGTAGGTAAAGAAGG - Intergenic
1081836459 11:46159566-46159588 AAGGGAACTTTTGGGGAAGATGG + Intergenic
1082100396 11:48168468-48168490 CAGTGGACTTTGGGGAAGGAGGG - Intronic
1082105638 11:48218251-48218273 CAGGGAATATTTAGGAAGGAGGG + Intergenic
1082181106 11:49120862-49120884 CAGGGAAATGGAAGGAAGGAAGG - Intergenic
1083730335 11:64649266-64649288 ATGGGAAACTTTGGGAGGGAGGG - Intronic
1084290505 11:68162630-68162652 CAGTGAATGTTTTGGAAGGAGGG - Intronic
1084343741 11:68528595-68528617 CAGGGAAATTTTCACAAGAAGGG - Intronic
1084655308 11:70511799-70511821 CAGGGAATTTCTGTGAAGAATGG + Intronic
1085185922 11:74576157-74576179 CAAGGAAACTTTGGGGATGATGG + Intronic
1085721262 11:78914285-78914307 CAGGGAATTTCTTGGAAAGAAGG + Intronic
1086336509 11:85806505-85806527 AAGGGAATTTTGGGGAAGGTAGG - Intronic
1087318067 11:96627913-96627935 AAGAGGAATTTTGGGAAAGATGG + Intergenic
1088132984 11:106518013-106518035 AAAGGAAATTTTGTGAAGAAAGG + Intergenic
1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG + Intronic
1089730467 11:120515826-120515848 TGGGTAAATTATGGGAAGGAAGG + Intronic
1090542153 11:127719116-127719138 CAGGCAAAAAGTGGGAAGGAAGG + Intergenic
1093286530 12:17270404-17270426 CAGAGAAAGTTGGGCAAGGATGG + Intergenic
1093388608 12:18589558-18589580 CAGGGCATTTTTATGAAGGAAGG + Intronic
1094053714 12:26247246-26247268 TAGGGCAATATTGGGAAGGATGG + Intronic
1095460279 12:42436344-42436366 CAGGGGAATTTCCTGAAGGAGGG - Intronic
1095813384 12:46395614-46395636 CTTGCAAATTTGGGGAAGGAGGG + Intergenic
1096558327 12:52418013-52418035 CAGGTAAATTTTGGCAGGGCAGG + Intergenic
1096800677 12:54108400-54108422 CAGGGAAAGAGTGGGAAAGAGGG + Intergenic
1096847710 12:54417261-54417283 AAGGGAAATTTAGGGGAGGGGGG + Intronic
1097474344 12:60034850-60034872 CAGGAAAATGTGGGGAAGTATGG - Intergenic
1099030297 12:77518105-77518127 GTGGGAAATTGTGGCAAGGAAGG + Intergenic
1099334769 12:81341022-81341044 GAGGAATATTTTTGGAAGGAGGG + Intronic
1101264219 12:103066745-103066767 CAAGGAAATTTGGGGAAGAGTGG + Intergenic
1102684541 12:114714419-114714441 CAGAGAAATCATGGCAAGGATGG - Intergenic
1102773697 12:115500689-115500711 AAGGGGAGGTTTGGGAAGGAGGG - Intergenic
1102946028 12:116989050-116989072 CAGGGAAGTTGGGGGAAGGGAGG - Intronic
1103563783 12:121805327-121805349 CAGGGAAGTTTTGGCGGGGAGGG + Intronic
1104180030 12:126370544-126370566 GAGGACAATTTTGGGAGGGAAGG + Intergenic
1104542983 12:129684650-129684672 CAGGAAAATGTTGGGAAGTTTGG + Intronic
1105426166 13:20296762-20296784 CAGGGAACTTCAGGGACGGATGG - Intergenic
1106233821 13:27844513-27844535 CAGGGAAGCTTTGGGACTGATGG + Intergenic
1106665618 13:31847354-31847376 CAGGGGAATTTTCTCAAGGAAGG - Intergenic
1107001395 13:35549785-35549807 CAAGGGAATTTGGGGAAGCAGGG + Intronic
1107115919 13:36745427-36745449 GAGGGAAATATTGGTAAGGATGG + Intergenic
1107166893 13:37292869-37292891 CAGGGAAATTTTGAGAAAAAAGG + Intergenic
1107315683 13:39129202-39129224 AAGTGAAATCTTGTGAAGGAAGG + Intergenic
1107687666 13:42920282-42920304 TAGGGTAATTTTGGGGAGAATGG - Intronic
1108190094 13:47929474-47929496 CAGGGAAATGAAGGGAAGCAGGG + Intergenic
1108306507 13:49140871-49140893 CAGGGAAGTTTTCCTAAGGAAGG + Intronic
1110184829 13:72660582-72660604 CATTGAAGTTTTGGGAAGGAAGG - Intergenic
1110343517 13:74419410-74419432 GAGGGAAACCATGGGAAGGAAGG - Intergenic
1111655587 13:91148464-91148486 CAGGGAACTTTCTGGAAAGACGG + Intergenic
1111703538 13:91720179-91720201 CACGGAATTTTGGAGAAGGAAGG - Intronic
1112144196 13:96679716-96679738 CAGGCAACTTCTGGGAAAGAAGG - Intronic
1112153193 13:96786842-96786864 GAGGGAGATTTTGGGAATTATGG - Intronic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1112512347 13:100020870-100020892 CGGGGGACTGTTGGGAAGGAAGG + Intergenic
1113412132 13:110099828-110099850 GAGGGAAATGTTGGAAATGATGG + Intergenic
1114357201 14:21924247-21924269 TATGGAAACTTTGGGAAGGAGGG + Intergenic
1114893897 14:26961487-26961509 GGGGGAAAAGTTGGGAAGGAAGG - Intergenic
1115186881 14:30698773-30698795 CAGGGAGATTGTGGAGAGGAAGG + Intronic
1115747324 14:36450851-36450873 AAGAGAACTTTTGGGAAGGATGG - Intergenic
1115749838 14:36478015-36478037 AATGTAAATTTTTGGAAGGAAGG + Intronic
1117476467 14:56100401-56100423 CAGAGAAATTTAAGGAAGAAAGG + Intergenic
1118522383 14:66598917-66598939 CTGGGATAGTTTGGGAGGGAAGG + Intronic
1118631396 14:67706933-67706955 CAGAGAAATTAGGGGGAGGAAGG + Intronic
1120523053 14:85547175-85547197 TAGGGAAAGTTTGAGAAAGAGGG - Intronic
1122974227 14:105164445-105164467 CTGGGAAGGTGTGGGAAGGAGGG + Intronic
1124037959 15:26073795-26073817 CAGGGAGAATTTGGGTTGGAAGG - Intergenic
1124624276 15:31299176-31299198 CAGGGGAATGCAGGGAAGGAGGG + Intergenic
1125606739 15:40943767-40943789 CAGAGAAACTTTGGGGATGAAGG - Intergenic
1125718785 15:41835256-41835278 CAGGGAAGATATGGGAAGGAGGG + Intronic
1127733473 15:61820715-61820737 GAGGGAAATGTTGAAAAGGATGG - Intergenic
1127747004 15:61988225-61988247 AAGGGAACTTTTTGGAAGGATGG + Intronic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128056889 15:64706427-64706449 CAGGGATTTTGTGGGAGGGAGGG - Intergenic
1130578581 15:85115226-85115248 CAGGCTAATGCTGGGAAGGATGG - Intronic
1131256611 15:90867044-90867066 GAGGAAACTTTTGGGAATGATGG - Intergenic
1131321855 15:91401202-91401224 CAGGAGGAGTTTGGGAAGGATGG + Intergenic
1131386849 15:92015048-92015070 CAGAGAAATACTGGGAAGCAGGG + Intronic
1131799149 15:96051999-96052021 TAGAGAGATTTTGGGAAAGAAGG + Intergenic
1132133037 15:99302683-99302705 CAGGGAACTTTTTGCAATGACGG - Intronic
1132405474 15:101539668-101539690 CATGGAAGTGTTGAGAAGGACGG + Intergenic
1132977562 16:2718196-2718218 CAGGGCTACTTTAGGAAGGAAGG - Intronic
1133526780 16:6613290-6613312 AAGGGTAAACTTGGGAAGGATGG + Intronic
1133663754 16:7944951-7944973 CAGGGAGATTATTGGCAGGAAGG - Intergenic
1133687713 16:8181964-8181986 CAAGGACATTATGGGAAGGAAGG + Intergenic
1134569482 16:15279234-15279256 CAGTGAAATAGTGGAAAGGAGGG + Intergenic
1134732895 16:16476815-16476837 CAGTGAAATAGTGGAAAGGAGGG - Intergenic
1134934544 16:18235156-18235178 CAGTGAAATAGTGGAAAGGAGGG + Intergenic
1135174398 16:20215257-20215279 CAGGGTAGTTCTGGGGAGGAGGG + Intergenic
1135866009 16:26102612-26102634 CATGGCAATTGTGGGATGGAGGG - Intronic
1136232327 16:28894043-28894065 GAGGGAAATGGTGGGAAGGTAGG + Intronic
1136380794 16:29894424-29894446 CAGGGAAAGGGTGGGAGGGAGGG - Intronic
1137473093 16:48780065-48780087 AAGGGAAATTTGGGGAGTGATGG - Intergenic
1137954205 16:52812550-52812572 GAGGGACATCTTGGCAAGGAAGG + Intergenic
1138910344 16:61389419-61389441 CAGGAAAATTTAAGGAAGGAGGG + Intergenic
1139137137 16:64218138-64218160 CTGGGAAATCTTGGCAAGGAGGG + Intergenic
1139838118 16:69856327-69856349 CAAGGAAATTTTGGGAGCAATGG + Intronic
1139982526 16:70871593-70871615 CAGGAATATTTAAGGAAGGATGG + Intronic
1141059445 16:80852480-80852502 CAGGGAAAGTTCAGGAAGGAGGG - Intergenic
1141171224 16:81692916-81692938 CAGGGAACTTTCGGGAATGGGGG + Intronic
1145060602 17:19730970-19730992 CAGAGAAATTTTGGGAAAGAAGG + Intergenic
1145721382 17:27076100-27076122 TAGGGAAATTTGGAGTAGGAAGG - Intergenic
1146546838 17:33747521-33747543 CAGGTAAAGTGTGGGAAGGATGG - Intronic
1147424160 17:40337857-40337879 CAGGGAAAGAGTGGGAAGCAGGG - Intronic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1149560467 17:57604703-57604725 CAGGGGATTCTGGGGAAGGAAGG + Intronic
1150015307 17:61550988-61551010 CAGTGATTTTTTGGGAAAGATGG - Intergenic
1151529203 17:74693591-74693613 CAGGGTACTTTCTGGAAGGAAGG + Intronic
1151552535 17:74830275-74830297 CAGGGATATTCTGGAAGGGAGGG + Intronic
1151709330 17:75792695-75792717 CAGGGTGATTTTGGGAGTGATGG + Intronic
1152241912 17:79165410-79165432 CTGGGAAAGCCTGGGAAGGAGGG + Intronic
1152400051 17:80060577-80060599 CAAGAAAATTTTGAAAAGGAAGG + Intronic
1152892214 17:82888990-82889012 CCGGGTGCTTTTGGGAAGGACGG + Intronic
1203173778 17_GL000205v2_random:175903-175925 CAGGGAAATTTTGTCAGAGAGGG - Intergenic
1153993545 18:10420673-10420695 CAAGGAAAGTTTGGCAAGGCAGG + Intergenic
1155242901 18:23880227-23880249 CAGTGAGATTTGGGGAAGGAAGG + Intronic
1157127339 18:44969462-44969484 CAGGAAAGGCTTGGGAAGGAGGG - Intronic
1157504078 18:48213765-48213787 CTGGAAAATTTTGGCAGGGATGG + Intronic
1157628776 18:49075498-49075520 CAAGGAAATGTAGGGAAAGAAGG + Intronic
1157786659 18:50489571-50489593 CAGGGATTTTATGGGAAGGGAGG - Intergenic
1159435898 18:68416495-68416517 TAGGGTGATTTTGGGAAGGAGGG - Intergenic
1159886367 18:73911529-73911551 CACGGAAATGTTGGGGAGGCCGG + Intergenic
1163239169 19:16048824-16048846 CATGGATATTTTTGGAAGGCGGG + Intergenic
1163339784 19:16698045-16698067 CAGAGGAATTTTGGGAGGGAAGG + Intergenic
1164210531 19:23093800-23093822 CAGGGGCATGGTGGGAAGGAAGG + Intronic
1164786694 19:30936734-30936756 CAAGGGAATTTTTGGAATGATGG - Intergenic
1166015769 19:39978260-39978282 CAGGGAAGGTTGGGGTAGGAAGG + Intronic
1166215762 19:41333800-41333822 CTTGGATATTTTGGAAAGGATGG - Intronic
1166685352 19:44793293-44793315 GAGGGAAATGCTGGGAGGGAAGG - Intronic
1167118370 19:47501293-47501315 GAGGGGTATTTTGGGAAGCAAGG + Intronic
1167164949 19:47792508-47792530 CAGGGAAATTTGGGGGCTGATGG - Intergenic
1168141226 19:54388634-54388656 CAGAGAAAATTTGGAAAGGTGGG - Intergenic
1168283205 19:55316991-55317013 GAGGGAGACTCTGGGAAGGAGGG + Intronic
1168337901 19:55606557-55606579 GAGGCACATTCTGGGAAGGAAGG - Intronic
1168654117 19:58114310-58114332 TTGGGAAATTTTGAAAAGGATGG + Intronic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
927267100 2:21163094-21163116 CAGTGAAATTGTGGGAATTATGG + Intergenic
927542254 2:23923530-23923552 CAGGGAAACTTTAGGAATGACGG + Intronic
928001323 2:27525230-27525252 CAAGGAAAGTTTTGGAAGAAAGG + Intergenic
928242688 2:29600431-29600453 CATAGAAATTTTGGAAATGAAGG + Intronic
928423663 2:31160192-31160214 CAGGGAGTTTTATGGAAGGAGGG - Intergenic
928748632 2:34445357-34445379 CAGGAAATGCTTGGGAAGGAGGG - Intergenic
928823176 2:35387785-35387807 CAAGGAAAATTTGGGAAGGATGG + Intergenic
929640621 2:43575476-43575498 TAGGGAAATTTGGGGGATGATGG + Intronic
931369331 2:61647729-61647751 AAGTGACATTTTGGGATGGATGG + Intergenic
931589624 2:63868296-63868318 GGGTGAAATTTTAGGAAGGATGG + Intronic
932148125 2:69342638-69342660 CAAGGAAATTTTGGGAGTGATGG + Intronic
932959032 2:76390299-76390321 CAAGGAAAGTTTGGGGAGGGAGG + Intergenic
933232978 2:79830340-79830362 AAGGGAAGTTCTGGGGAGGATGG + Intronic
933352972 2:81178709-81178731 CAGGGAAATACTGGGGAGAAGGG - Intergenic
933531835 2:83520427-83520449 GAGGGAAATTGTAAGAAGGAGGG + Intergenic
933697873 2:85233697-85233719 CAGGGAAATTTGGGGGTGGGTGG - Intronic
934672721 2:96225539-96225561 CAGGGAACTTTTCAGAATGATGG - Intergenic
935114266 2:100121073-100121095 CAGAGAAATTCTGGGAGGGCAGG + Intronic
935138754 2:100332788-100332810 CAGGGAAGTGTTGGGTAGGGTGG + Intergenic
935665615 2:105509726-105509748 CAGGGCAATTATCGGGAGGAGGG - Intergenic
936097060 2:109538427-109538449 CAGGGAGAGTTTGTGAAAGACGG + Intergenic
936229772 2:110690005-110690027 CAGGGAAATTATAGACAGGAAGG - Intergenic
936255832 2:110910101-110910123 GAGGGAACTTTTGGGGATGATGG - Intronic
937165549 2:119812500-119812522 GAGGGAAATTTTTGTAATGAAGG + Intronic
937654884 2:124363383-124363405 CAGGGAGATGTTAAGAAGGAGGG - Intronic
939093257 2:137803137-137803159 AAGGGAAAGATTGGAAAGGAGGG - Intergenic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
939592854 2:144086901-144086923 CAGGGAGATTCTGGGAATCAGGG - Intronic
939681360 2:145138061-145138083 GAGAGAAAGTTTGGCAAGGATGG - Intergenic
939834672 2:147114091-147114113 CAGGAAACTTTTGGGAGTGATGG - Intergenic
941555465 2:166974541-166974563 CAGGGAAATTTTAAGAAGCTTGG - Intronic
941653059 2:168114366-168114388 CAGGGAACATTTTGTAAGGAAGG - Intronic
941802340 2:169673761-169673783 GAGGGAAATTTTGGGAGTGATGG + Intronic
942044901 2:172094653-172094675 CAGGGCAGTTTTGGGAAGGTGGG + Intergenic
942576000 2:177364045-177364067 CAGGGCAACATTGGGAGGGAGGG - Intronic
942745930 2:179233116-179233138 CAGGGAAAATTTAGGAAGAAAGG + Intronic
943348071 2:186764123-186764145 CAGGGAAATTTTAAGAAAAATGG - Exonic
943384552 2:187185064-187185086 CAGGGAAATTCTGGGCAGAAAGG - Intergenic
944334857 2:198520457-198520479 CAGAGAAGTTTTGAGAAGGCTGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945132577 2:206589465-206589487 AAGGGAAACTGCGGGAAGGATGG + Exonic
945416908 2:209585121-209585143 AAGGGAAGTTTAGGGAGGGAGGG + Intronic
945753336 2:213815346-213815368 CAAGGGAATTTGGGGAATGATGG + Intronic
946318842 2:218936432-218936454 TATAGAAGTTTTGGGAAGGAGGG + Intergenic
946467881 2:219928426-219928448 CAGGGAACTCTTGGGAGAGAGGG - Intergenic
947705613 2:232273168-232273190 CAGGGAAACCCTAGGAAGGAGGG - Intronic
948391948 2:237618208-237618230 CAAGGAAATTTTGGGGGTGATGG - Intergenic
948441978 2:237998267-237998289 GAAGGAAACTTTGGGAATGATGG - Intronic
1168831453 20:847289-847311 CTGGGCAGTTTGGGGAAGGAAGG + Intronic
1170478566 20:16742619-16742641 AAGGGAAATTTTGGGGGTGATGG - Intergenic
1170576882 20:17670680-17670702 CAAGGATATTCTTGGAAGGAAGG - Intronic
1171795777 20:29565951-29565973 CAGGGAAAGATTGGGAAAGAGGG - Intergenic
1171852452 20:30318191-30318213 CAGGGAAAGAGTGGGAAAGAGGG + Intergenic
1171956055 20:31464679-31464701 TGGGGAAATTTTGGGAGGAAGGG - Intergenic
1172175615 20:32970327-32970349 CATGGATATTTTGGAAAGTAGGG + Intergenic
1172792882 20:37518504-37518526 CAGTAACATTCTGGGAAGGAAGG + Exonic
1173399355 20:42710715-42710737 CAGTGGAATTGTGGGAATGAGGG + Intronic
1173757981 20:45535006-45535028 GAAGGATATTTTGGGAAAGAGGG - Intronic
1174383024 20:50169640-50169662 CAGGGAGAGATTTGGAAGGAAGG + Intergenic
1175193612 20:57227526-57227548 CAGGGAAATTGATGGAAGAAAGG - Intronic
1176329767 21:5537549-5537571 CAGGGAAATTTTGTCAGAGAGGG - Intergenic
1176397990 21:6283402-6283424 CAGGGAAATTTTGTCAGAGAGGG + Intergenic
1176439167 21:6705702-6705724 CAGGGAAATTTTGTCAGAGAGGG - Intergenic
1176463429 21:7032771-7032793 CAGGGAAATTTTGTCAGAGAGGG - Intergenic
1176486990 21:7414550-7414572 CAGGGAAATTTTGTCAGAGAGGG - Intergenic
1177002006 21:15624807-15624829 CAGGCAAGTTGTGGCAAGGAGGG + Intergenic
1177604571 21:23360913-23360935 CAGGAAAATGTGGGGAAGTATGG - Intergenic
1178097867 21:29234859-29234881 CAGGGAAATACTGGGTAGAAGGG - Intronic
1179514948 21:41899886-41899908 GGGGGAAAGTTTGGGGAGGAGGG + Intronic
1180081983 21:45491222-45491244 CAGGGAGATCCAGGGAAGGACGG + Exonic
1180123672 21:45770997-45771019 CAGTGGAAATTTGGGAAAGATGG + Intronic
1180333512 22:11554746-11554768 CTGGGAAATATTGAGAAGAATGG + Intergenic
1180700060 22:17776360-17776382 CAGGGAAATTCCGGGGATGATGG + Intergenic
1182248525 22:28980479-28980501 AAGGGATATTTTGGGAAGGAAGG - Intronic
1182555954 22:31128377-31128399 CAGGGAGACTTTGGGAAGAGGGG + Intronic
1182680351 22:32074560-32074582 CTGGGAAATGCTGGGAAGGCTGG - Intronic
1182933569 22:34197863-34197885 GAGGGCAAATTTGGGATGGATGG - Intergenic
1183792462 22:40083878-40083900 CAGGGAAGGGTTGGGGAGGAGGG + Intronic
1184529143 22:45043367-45043389 CAGGGAAGGTGTGGGGAGGAGGG + Intergenic
1185375327 22:50480391-50480413 CAGGGAACAGTGGGGAAGGAGGG - Intergenic
950092771 3:10308192-10308214 GAGGAAACTTTTGGGAATGATGG - Intronic
951043436 3:18012891-18012913 CCGTGAATTTGTGGGAAGGAAGG - Intronic
952331020 3:32364629-32364651 AAGTGAACATTTGGGAAGGATGG - Intronic
953540649 3:43814722-43814744 CATGGAAATTGTGGGCATGAGGG + Intergenic
954071204 3:48144065-48144087 CAGGGAAATTGTGGGATAGGTGG - Intergenic
954382112 3:50225007-50225029 CAGGGCACTTTTGTGAGGGAGGG + Intergenic
954449388 3:50563477-50563499 TAGGGAAGATTTGGAAAGGAAGG - Intronic
954893305 3:53952880-53952902 CAGGGAAATTGTGGGAAATTTGG + Intergenic
955242362 3:57189619-57189641 GAGGGAATTTTGGGGGAGGATGG - Intergenic
955732093 3:61997792-61997814 CAGGGAAATTAGTGGAAGGCTGG + Intronic
956019954 3:64923615-64923637 GTGGGTAACTTTGGGAAGGAAGG + Intergenic
956722439 3:72130133-72130155 CAGGGATATTTTGAAAAGCATGG + Intergenic
957035004 3:75285935-75285957 TAGGGAACTTTTCGGAATGATGG - Intergenic
958259968 3:91368820-91368842 CAGGGAAAGTTTGTGCAGAATGG + Intergenic
958738461 3:98038554-98038576 AAGAGAAAATTTGGAAAGGATGG + Intergenic
958841806 3:99214366-99214388 TAGGGAAGTTTTGAGAAGGGAGG + Intergenic
959333221 3:105033123-105033145 GAGGGAAATTTGGGTAAGCATGG + Intergenic
960280573 3:115777263-115777285 CAGGGACATTTTTGGTTGGAGGG + Intergenic
960295496 3:115938245-115938267 CAAGGTAATTTTGGCAAGTATGG - Intronic
961708562 3:128808880-128808902 CAGGGAAATTCTGGCATGGGTGG + Intronic
962436768 3:135374059-135374081 AAGGGAAGTTTTGGCAAGGCTGG + Intergenic
963549579 3:146702835-146702857 CAGGGCCAATCTGGGAAGGATGG - Intergenic
964406320 3:156352624-156352646 CAGGGAGACTTTGGTAAAGATGG - Intronic
965075859 3:163974597-163974619 CAGAGAATTATTGGGAAGCAGGG + Intergenic
966555445 3:181254341-181254363 AAGGCAAATTTTGGCAAGAAAGG + Intergenic
967142692 3:186574991-186575013 AAGGCAAATTTTGAAAAGGATGG + Intronic
968864002 4:3196057-3196079 CAGGGAAACCCTTGGAAGGAGGG + Intronic
968902210 4:3437060-3437082 CAGGGAAATGCTGGGCAAGAAGG + Intronic
971178463 4:24304690-24304712 CAGGACACTTTTGGGAATGAGGG + Intergenic
972313054 4:37899270-37899292 AAAAGAAATTCTGGGAAGGAGGG + Intronic
973635273 4:52856581-52856603 CCGGGAAATCTGGGGAGGGAGGG - Intergenic
973876825 4:55228540-55228562 CATTGGAATTTTGGGAGGGAAGG + Intergenic
975032162 4:69634380-69634402 CAGGGAAAGGGTGGGAAGCAGGG + Intronic
975297275 4:72749296-72749318 CAGAGAAATTCTGGGAGGGAAGG + Intergenic
975367773 4:73548554-73548576 CAGAGACATTTTGGGAAGGAAGG - Intergenic
976119377 4:81762791-81762813 CAAAGAAAGTTTTGGAAGGACGG - Intronic
976365013 4:84223286-84223308 CATGGAAATTATGGGAATTATGG + Intergenic
976923121 4:90462346-90462368 GAGGGAACTTTTGACAAGGATGG + Intronic
977672842 4:99716009-99716031 CAGGGAAATTTTGGGCAGAAGGG + Intergenic
978077737 4:104553856-104553878 CAGAGAAGTTTTGGGAGGCATGG + Intergenic
978884012 4:113744421-113744443 GAGGGAATTTTTGCAAAGGAGGG - Intronic
978897167 4:113903018-113903040 AAGGAACATATTGGGAAGGAGGG - Exonic
978912959 4:114086757-114086779 CAGGAAATTTTTGAAAAGGATGG + Intergenic
980871403 4:138615434-138615456 CAGGGAAATACTGGGTAGAAGGG + Intergenic
980877538 4:138677041-138677063 CTGGGAAATTTTGGGAAGTGGGG - Intergenic
980884001 4:138742435-138742457 CAGGGAAATTTTAGGAAGAAAGG + Intergenic
981362718 4:143866221-143866243 CAAGGAAATATTGGGTAGAAGGG + Intergenic
981373450 4:143987022-143987044 CAAGGAAATATTGGGGAGAAGGG + Intergenic
981382552 4:144090276-144090298 CAAGGAAATATTGGGTAGAAGGG + Intergenic
981504755 4:145486949-145486971 CAGTGTAATTTAGGGAAGGGAGG + Intronic
981594965 4:146409498-146409520 CAGGGAAACTTTGGGGGTGATGG + Intronic
981747358 4:148064324-148064346 CAGTGAGATTTGGGGAAGGGGGG + Intronic
981815915 4:148830201-148830223 CAGGGAAATACTGGGTAGAAGGG - Intergenic
982118839 4:152119725-152119747 GAGGGAACTTTTTGGAAAGATGG - Intergenic
984053734 4:174899645-174899667 CAGGGTAGGTTTAGGAAGGAAGG + Intronic
984868453 4:184306062-184306084 CTGGGAAATTTTGGGGGTGATGG + Intergenic
985036610 4:185846795-185846817 CAGGGAAAGTTTGGGAGAGAGGG + Intronic
987523261 5:19015145-19015167 CAGGCAAATTTCTGTAAGGATGG - Intergenic
988586052 5:32508526-32508548 CAGGAAAAATTTGTGAAGGAGGG + Intergenic
989788952 5:45368944-45368966 GAGGGAACTTTTGGAACGGATGG - Intronic
990170670 5:53045689-53045711 AATGGAAATTTTCTGAAGGATGG + Intronic
990285347 5:54296189-54296211 CAGGGAGATTTTTGGAAGGCTGG + Intronic
991653998 5:68884648-68884670 CAGTGAATTTTTTGGAAGGTTGG + Intergenic
992021710 5:72631450-72631472 CAGTGAAGTTACGGGAAGGAAGG + Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
992605102 5:78447935-78447957 CAGGGAAAGAGGGGGAAGGAGGG - Intronic
993168844 5:84389762-84389784 CAGTGAAATATTAGGAAGTAGGG - Intergenic
993289060 5:86041337-86041359 CAGGGATATTGAGGCAAGGAGGG - Intergenic
994608665 5:102007333-102007355 CAGATAAATATCGGGAAGGAAGG - Intergenic
994898781 5:105744103-105744125 CAGGGAAATTCTGGGCAGACAGG + Intergenic
994924255 5:106093863-106093885 CAGAGAAATTTATGGATGGATGG - Intergenic
995174763 5:109162961-109162983 GAGGGAACTTTTGGGGATGATGG - Intronic
995219329 5:109630373-109630395 CAGAGAATTGTGGGGAAGGAAGG + Intergenic
995561330 5:113384829-113384851 CAGGGAAAGTGTGGCCAGGAGGG + Intronic
995793963 5:115922787-115922809 TAGGGTAATTTTGGGAAGCTTGG + Intergenic
996375497 5:122802357-122802379 GAGGGAAATGATGGGGAGGAGGG + Intronic
998102899 5:139449035-139449057 AAGGTGAATTTGGGGAAGGAAGG + Intronic
998172703 5:139881884-139881906 CAGGGAAACTCTGAGAAGGAAGG - Intronic
999013340 5:148068253-148068275 CTGGGAAATTTAGCTAAGGATGG - Intronic
999127855 5:149259543-149259565 CAGGGAAACTTTTGGAAGAGTGG + Exonic
1000350242 5:160347159-160347181 CAGGGAGAGTGTGGGAATGATGG - Intergenic
1000474863 5:161693889-161693911 TAGGGAATTCTTGGGAAGGGTGG - Intronic
1001129339 5:169050821-169050843 CATGGAAATTTCTGGAAGGGTGG - Intronic
1002099925 5:176852443-176852465 CAGGGAAAACTGGGGAAGGAAGG - Intronic
1002955613 6:1860496-1860518 CAGGGGAATTTTGTGCAAGATGG + Intronic
1003194887 6:3905932-3905954 CCTGGAAATATAGGGAAGGAGGG + Intergenic
1003381443 6:5628257-5628279 CAGGGAAAATTTCTGAAGGAAGG + Intronic
1004188247 6:13440834-13440856 CAGGGAAATTTTGGCAAAGCTGG - Intronic
1004589153 6:17031848-17031870 CAGGGAAGTTGTGGGGAGGGTGG + Intergenic
1004698212 6:18053994-18054016 CAGTGACATGTTGGGAAGGAAGG + Intergenic
1005686852 6:28261433-28261455 CAGGGTAATTTTGGGCAAGGGGG + Intergenic
1005970116 6:30754254-30754276 CAGGGAACTTTTGGGGGTGATGG - Intergenic
1006273297 6:32980873-32980895 CAGGGACATTTACTGAAGGAGGG + Exonic
1007825184 6:44594831-44594853 CAAGGCTATTCTGGGAAGGAGGG + Intergenic
1008995271 6:57651586-57651608 CAGGGAAAGTTTGTGCAGAATGG - Intergenic
1009183805 6:60550346-60550368 CAGGGAAAGTTTGTGCAGAATGG - Intergenic
1010141815 6:72621853-72621875 CGGGGGCAGTTTGGGAAGGAGGG + Exonic
1010234794 6:73566453-73566475 CAGGCCAATTTTGGGGAGGTGGG - Intergenic
1010353329 6:74901954-74901976 TGGAGAAAATTTGGGAAGGAAGG - Intergenic
1010919951 6:81668947-81668969 CAGGGACATTTTCTGGAGGAAGG - Intronic
1011443530 6:87412593-87412615 CAGAGAAATTTTGTGAAGAGAGG + Intronic
1012110177 6:95220513-95220535 CACAGAAATTCTGGGAAGAAAGG + Intergenic
1012271874 6:97223194-97223216 CAGAGAAATTATAGGTAGGAAGG - Intronic
1013845453 6:114445213-114445235 GAGGGAAAATTGGGGAAGGTAGG + Intergenic
1013847371 6:114469852-114469874 AAGGGAGATTTTGGAAGGGATGG + Intergenic
1014912480 6:127111431-127111453 CAGGGGATTTTTGATAAGGATGG + Intergenic
1016569157 6:145492978-145493000 CAGAGAAATTCTGGGTAGAAAGG - Intergenic
1017010360 6:150059249-150059271 GAGGGAAACTTTGTCAAGGAAGG - Intergenic
1017462381 6:154663481-154663503 AATGGAAAATATGGGAAGGAAGG - Intergenic
1019233494 6:170588077-170588099 AAGAGAAAATTTGGGGAGGAAGG + Intergenic
1019501548 7:1367247-1367269 CAGGGGATTCCTGGGAAGGAGGG - Intergenic
1021058908 7:16085298-16085320 CAGGAAAATTTTGGGGTGAATGG - Intergenic
1021216421 7:17921395-17921417 GAGGGAAAGTTTAGGAGGGATGG - Intronic
1022367708 7:29741399-29741421 CAGGGAACTTGTGGGAGTGATGG + Intergenic
1022928474 7:35082468-35082490 CAGGGAACTTGTGGGAGTGATGG - Intergenic
1023311634 7:38893286-38893308 CTGGGAGTCTTTGGGAAGGAGGG - Intronic
1025971506 7:66330429-66330451 CAGAGAAATTGAGGGAAAGATGG - Intronic
1026278194 7:68898957-68898979 CAGGGAATTTTTGCTAAGGTGGG + Intergenic
1027425934 7:78061536-78061558 GAGGAATATTTTGGGAGGGAAGG + Intronic
1028215758 7:88130837-88130859 AAGGGAAGATTTGGGAAGTATGG - Intronic
1029521821 7:101067633-101067655 CAGGGCAATTTTGGAAGGCATGG - Intergenic
1029831919 7:103269318-103269340 CAGGGAAAGTTCGGGATGGAGGG + Intergenic
1030133079 7:106219576-106219598 AAGTGAAATCTTGGGGAGGAAGG - Intergenic
1031192771 7:118575802-118575824 CTGGGAAGTTTCAGGAAGGAAGG + Intergenic
1032622189 7:133546634-133546656 TAGGGAACTTTTGAAAAGGAAGG - Intronic
1032994775 7:137432815-137432837 CAGGGAAATATTGGGAAGGAAGG - Intronic
1033021585 7:137730519-137730541 CATTCATATTTTGGGAAGGATGG - Intronic
1033123014 7:138683035-138683057 CAGGGAAATTTTAGCAAGTTTGG + Intronic
1033655807 7:143373461-143373483 CTGGGGGATTTTAGGAAGGAGGG + Intergenic
1034830731 7:154305352-154305374 CAAGGCTATTTTGGGGAGGATGG - Exonic
1035966860 8:4201876-4201898 CATGGAAATTTTGGGGGGGGGGG + Intronic
1036114069 8:5939554-5939576 AAGAGAAATTCTGGGATGGAAGG + Intergenic
1036245041 8:7108826-7108848 CAGGGAAATCTAAGGAAGGGTGG + Intergenic
1037321577 8:17648596-17648618 CAGGAAATTTTTGTAAAGGAAGG - Intronic
1037636105 8:20702103-20702125 CTGGGAAAGCTGGGGAAGGAGGG + Intergenic
1037986568 8:23294151-23294173 GAGGGAGATTGTGGAAAGGAAGG + Intronic
1038524957 8:28264658-28264680 CAGGCAAAGATTGGGAAAGATGG + Intergenic
1039091603 8:33835579-33835601 CAAGGAAATGTTGTGAAGGGTGG + Intergenic
1039836489 8:41260380-41260402 TTGGGAAAGTTTGGGAAGGTTGG - Intergenic
1039900472 8:41748604-41748626 CAGAGAAAGGTTGTGAAGGAAGG - Intronic
1039978230 8:42384931-42384953 CAGAGACAGTTTGGGAAAGAAGG - Intergenic
1041153648 8:54961785-54961807 CAGGCCCATTTTGGCAAGGAGGG + Intergenic
1041460819 8:58109560-58109582 TATGGAAATTCTGGGGAGGAAGG + Intronic
1042334973 8:67620452-67620474 CAGTGTGATTTAGGGAAGGAAGG + Intronic
1043046559 8:75331095-75331117 CAGGGAACTTTTGGGGTTGATGG - Intergenic
1043365689 8:79531014-79531036 AAGAGAAATTTTGGGAGTGATGG + Intergenic
1045465752 8:102468311-102468333 GAGGGAAATTATGAGAAGGGTGG + Intergenic
1045478484 8:102574122-102574144 CAGGGACATCTTGGGAAAGAGGG - Intergenic
1045850774 8:106696118-106696140 CAGGGAAAGAAAGGGAAGGAGGG - Intronic
1046059622 8:109121976-109121998 CAGGGAATTTTTATTAAGGAGGG - Intergenic
1046462610 8:114560808-114560830 CAGGGAAATTATGGGAAAATTGG + Intergenic
1048332482 8:133480097-133480119 CAGGGAAGGATGGGGAAGGAGGG + Intronic
1049316190 8:141969683-141969705 CAGGCTAATTTGGGGAAGGGAGG - Intergenic
1050347600 9:4707853-4707875 CAGGCAAATCCTGGGAAAGAAGG - Exonic
1051365017 9:16315858-16315880 AAGGGTCATTCTGGGAAGGACGG + Intergenic
1052372252 9:27678372-27678394 AAGGCAAAATTTGGAAAGGAAGG + Intergenic
1052735772 9:32340884-32340906 CTGGGAAATTCTGGAAAAGAAGG + Intergenic
1053790244 9:41681489-41681511 CAGGGAAAGAGTGGGAAAGAGGG + Intergenic
1054154898 9:61633266-61633288 CAGGGAAAGAGTGGGAAAGAGGG - Intergenic
1054178590 9:61893190-61893212 CAGGGAAAGAGTGGGAAAGAGGG + Intergenic
1054474686 9:65564391-65564413 CAGGGAAAGAGTGGGAAAGAGGG - Intergenic
1054658943 9:67687639-67687661 CAGGGAAAGAGTGGGAAAGAGGG - Intergenic
1054992060 9:71339770-71339792 CAGGAGAATTTTGGGGATGATGG + Intronic
1055693835 9:78861544-78861566 CAGGTGATTTTTGGGGAGGAAGG - Intergenic
1056168709 9:83962385-83962407 CAGGGCAGTTTTTGGGAGGAAGG + Intergenic
1056255841 9:84798628-84798650 CCGGGAACTTTTGTGAAGAAAGG - Intronic
1056765581 9:89442793-89442815 CTGGGAAATGGTGAGAAGGATGG - Intronic
1056781587 9:89554972-89554994 CAGGGAAATGTGGGGACAGATGG - Intergenic
1057026531 9:91738227-91738249 AAGGGAAACTATGAGAAGGAGGG + Intronic
1059344753 9:113620616-113620638 CAGGGAAACAGCGGGAAGGAAGG - Intergenic
1059447738 9:114349381-114349403 CAGGGATGTTCAGGGAAGGAGGG - Intronic
1059553606 9:115255182-115255204 CAGGGATATTTTGTGAAGTGTGG + Intronic
1059562527 9:115348851-115348873 CAGGGAAATATGGGAAAGGTTGG - Intronic
1059944357 9:119393717-119393739 CAAGGAAACTTTGGAATGGAGGG - Intergenic
1060433553 9:123572116-123572138 AAGGGAAATTTGGGGGATGATGG - Intronic
1061196412 9:129109545-129109567 CAGGGAAACTGAGGCAAGGAGGG - Intronic
1061960796 9:133988083-133988105 CAGGGGAAATTCTGGAAGGAGGG + Intronic
1062201201 9:135303731-135303753 CAGGGAAATATTGGGAGGACTGG - Intergenic
1062709921 9:137969605-137969627 CAGGGCCACTCTGGGAAGGAGGG - Intronic
1203432328 Un_GL000195v1:102777-102799 CAGGGAAATTTTGTCAGAGAGGG + Intergenic
1186733329 X:12433846-12433868 CAGGGAAATATTTGTAAGCAGGG + Intronic
1186883413 X:13888995-13889017 CTGGGACATTTTGAGAAGCAAGG + Intronic
1186885721 X:13911403-13911425 CAAGGAAATTTTGGTGATGATGG + Intronic
1186933411 X:14419847-14419869 GGAGGAATTTTTGGGAAGGAGGG + Intergenic
1187324424 X:18273636-18273658 CAGAGAAATTCTGGGAGGGTGGG + Intronic
1187551285 X:20308178-20308200 CAGGGAAATTTCTGGAGCGAGGG - Intergenic
1187599940 X:20818046-20818068 AAAGGAAATTTTTGGAAGTATGG + Intergenic
1189304574 X:39977209-39977231 CAAGGAAACTTTGGGAATGATGG + Intergenic
1190175986 X:48149934-48149956 AAGGCAAATTTTGGGAAAAATGG - Intergenic
1191700509 X:64037120-64037142 AATGTAAATTTGGGGAAGGATGG + Intergenic
1192522501 X:71814797-71814819 CCGGGGCATTCTGGGAAGGAAGG + Intergenic
1195938245 X:110145309-110145331 CAGGGCAATTATGGGATTGAGGG + Intronic
1197188645 X:123619488-123619510 CAGAGGAACTTTGGGAAGTATGG + Intronic
1197291718 X:124666584-124666606 TAGGGAAATCATGGGAAAGAAGG - Intronic
1198086834 X:133290079-133290101 CAGAGAAATACTGGGAAGAAAGG - Intergenic
1198422695 X:136483288-136483310 CAGGGAATATTTAGGAAAGATGG - Intergenic
1199224853 X:145360736-145360758 GAGGGAATTTTAGGGAATGATGG + Intergenic
1199276970 X:145956057-145956079 CATTGGAATTTTGGTAAGGATGG - Intergenic
1200538215 Y:4425381-4425403 CAAGGAAATGTGGGGAAGGGAGG - Intergenic
1202340628 Y:23861231-23861253 CAGGGAATTTGTTGGAAGGATGG - Intergenic
1202530138 Y:25808851-25808873 CAGGGAATTTGTTGGAAGGATGG + Intergenic