ID: 992604933

View in Genome Browser
Species Human (GRCh38)
Location 5:78446170-78446192
Sequence CTGTACATACAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992604933 Original CRISPR CTGTACATACAGAAAGAGGA AGG Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
904634645 1:31870475-31870497 TGGTACATACAGAAACAGAACGG - Intergenic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905383413 1:37581071-37581093 AAGTACATACAGAGAGAGGATGG + Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
908143251 1:61209978-61210000 CTGTACTAACAGAAAAAGGCTGG - Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
909042481 1:70670603-70670625 CTGTACTTAAACAAATAGGATGG + Intergenic
909666823 1:78143386-78143408 CTGGCCATGCAAAAAGAGGAAGG - Intergenic
912423628 1:109566148-109566170 CTGTTCAGAAAGAATGAGGAGGG + Intronic
912917841 1:113834940-113834962 GTGTCCATACAGGAAGTGGAGGG + Exonic
913467878 1:119161196-119161218 CTGTACATAATGAAAGAAAATGG - Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
915168051 1:153959486-153959508 CTGTGCTTTGAGAAAGAGGAAGG + Exonic
916115506 1:161481945-161481967 CTGTCCATCCAGAAGGAGGTTGG - Intergenic
916249041 1:162718182-162718204 ATGTACACACAAAAAGATGATGG - Intronic
916549684 1:165838215-165838237 GTGTACACAAAGAAAGAAGAGGG - Intronic
917209469 1:172616675-172616697 CTGTCCATCCAGAAAAAGGAAGG - Intergenic
918268787 1:182874485-182874507 GTGTGCATACTGATAGAGGAAGG + Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
921712228 1:218384643-218384665 CTGTACATATTGAGAGAGGCTGG + Intronic
921916373 1:220615407-220615429 CTGTTCATATATAAAGAGAAAGG - Intronic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
923970805 1:239201189-239201211 CAGTACATAGAAAAAGTGGAGGG - Intergenic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
1063070368 10:2656886-2656908 CTCTTCAGACAGAAAGGGGAGGG - Intergenic
1063616820 10:7607477-7607499 CTCTACAGAAAGAAAGAGGAGGG + Intronic
1064347986 10:14549801-14549823 CTGTCCATACAGATAGTGAAAGG - Intronic
1064756320 10:18574676-18574698 CAGTACTTACAGAACCAGGAAGG + Intronic
1065056636 10:21850955-21850977 CTATACATACAGAATGAAGCAGG + Intronic
1070274808 10:74995517-74995539 TTGTACACAAAGAAACAGGAAGG - Intronic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1071262621 10:83934436-83934458 CTCTTCATAAAGAAAGAGGAGGG + Intergenic
1072336170 10:94400673-94400695 CTATACATACAGATATAAGAGGG - Intergenic
1072508591 10:96095203-96095225 CTATACAGACAGAAAGATTATGG - Intergenic
1072728454 10:97829061-97829083 CTGCCCAGACAGAAAGAGCAAGG - Intergenic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1074845241 10:117391846-117391868 CTGTTTATACAGGAACAGGATGG + Intergenic
1075204837 10:120437853-120437875 CTGAACATGATGAAAGAGGAAGG - Intergenic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1080694983 11:34595649-34595671 GTGTACACACAGAAGAAGGAAGG - Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1082294230 11:50418521-50418543 GTGTGCATACTGATAGAGGAAGG + Intergenic
1082682198 11:56188505-56188527 GTGAACATACATAAAGAAGAAGG + Intergenic
1083039734 11:59673861-59673883 CTGAAATTACATAAAGAGGAAGG + Intergenic
1084001959 11:66300703-66300725 CTGCACAGCCAGGAAGAGGAGGG + Intergenic
1084026204 11:66451358-66451380 CTGGACATACAGAAATGAGAAGG + Intronic
1086911182 11:92474498-92474520 CTGGGCATACAGGAAGGGGAAGG + Intronic
1087539682 11:99499864-99499886 CAATACATAAAGAAAGAGGTAGG - Intronic
1087703298 11:101461656-101461678 GTGTACAGACAGAAAGATAAAGG - Intronic
1088122459 11:106386310-106386332 ATTTACAAACAGAAAAAGGAAGG - Intergenic
1088556934 11:111071306-111071328 ATGGACATACAGAGAGAAGATGG + Intergenic
1088565888 11:111172575-111172597 CAGTACATCCAGAAAAAGAAAGG - Intergenic
1088744389 11:112793383-112793405 CATTACAGACAGAATGAGGATGG + Intergenic
1090169151 11:124582905-124582927 CTGTACCAACAGAAAGAGTCTGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091541466 12:1466288-1466310 CTGGACATACAGAAAGACACTGG - Intronic
1092680560 12:10975233-10975255 CCCTACAAACAGAAAGAGAATGG + Intronic
1093175111 12:15904768-15904790 CTGGACGTAAAGAAAGAGGAAGG - Intergenic
1093227853 12:16507171-16507193 TTCTACATACAGAAAGCAGAGGG + Intronic
1093261002 12:16937910-16937932 CTGGACCTACAGAAAGAGGCAGG - Intergenic
1094141913 12:27190072-27190094 CTCTACATACATATAGAGAAAGG - Intergenic
1095257907 12:40061944-40061966 CAGTATATACAGAAAAAGAAAGG + Intronic
1095828249 12:46553457-46553479 CTATAGATGCAGAAAGAAGAAGG + Intergenic
1096280958 12:50253137-50253159 CAGTAAATATAGAAAGAAGAGGG + Intronic
1096518142 12:52169649-52169671 CTGATCATGCAGAAACAGGAAGG + Exonic
1096880633 12:54666200-54666222 CTGTAAACACAAAAAGGGGAGGG - Intergenic
1097750977 12:63352470-63352492 CAGTACATACCGGCAGAGGAGGG + Intergenic
1097756565 12:63413588-63413610 CTGTACATGGTGAGAGAGGAAGG + Intergenic
1097904376 12:64905032-64905054 GTGTGCATGCAGGAAGAGGAGGG - Intergenic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100214643 12:92434959-92434981 CTGTCTCTAAAGAAAGAGGAAGG - Intergenic
1101320517 12:103669300-103669322 CTGTGCGAACAGACAGAGGAAGG - Intronic
1106221454 13:27749209-27749231 CTGTGCAGCCAGAAAGCGGAAGG + Intergenic
1106284268 13:28305583-28305605 CTGTATTTACAGAAACAGGTGGG - Intronic
1107303095 13:38986687-38986709 GTGTGCATAGAGAAAAAGGAAGG - Intronic
1107761812 13:43687722-43687744 CTGTAAATTCTGCAAGAGGAAGG - Intronic
1107763149 13:43703297-43703319 CTGTAGAAACATAAAGAGTATGG + Intronic
1112979432 13:105363774-105363796 CTGTTCTTCCAGAAACAGGAAGG + Intergenic
1115242595 14:31264560-31264582 CTGTCCTTAGAGAAAGAGTATGG + Intergenic
1116286673 14:42982105-42982127 CTGTACATATACAAATAGCATGG - Intergenic
1116300568 14:43176045-43176067 CTGTTCACAGAGAAAGAGAATGG - Intergenic
1116469579 14:45271427-45271449 TTGTCCACACAGAAAGAGAAAGG - Intergenic
1116900454 14:50357650-50357672 CTGTTGCTAGAGAAAGAGGACGG - Intronic
1118135099 14:63015472-63015494 ACGTACATACAGAGAGAGAAAGG - Intronic
1118855125 14:69614995-69615017 GTGTCCAGACAGAAAGAAGAGGG - Intronic
1119476637 14:74934342-74934364 CTATATACACACAAAGAGGAAGG + Intergenic
1119913235 14:78370717-78370739 CTTTACATATAAGAAGAGGAAGG + Intronic
1120673370 14:87389853-87389875 CTGGACTTCCAGAAAAAGGAAGG + Intergenic
1121568261 14:94926748-94926770 CTTTCCATTCAGAAAGAGAAAGG - Intergenic
1123799934 15:23809059-23809081 CTGTACATAAAGGTAGAGGCTGG - Intergenic
1125409820 15:39394253-39394275 GTGTACATCCAGACAGAGGCAGG + Intergenic
1125589015 15:40843477-40843499 CTGTACATACAAGATGAGGAGGG + Intergenic
1125716835 15:41824135-41824157 CTGTACCCACAGAAATGGGATGG - Intronic
1125826295 15:42679354-42679376 TGGAGCATACAGAAAGAGGAAGG - Intronic
1126941522 15:53771893-53771915 CTTTACAAACAGAAAAAGAATGG + Intergenic
1127924492 15:63525421-63525443 CTGCTCATTCTGAAAGAGGATGG - Intronic
1128050133 15:64656795-64656817 CTGGATCTAAAGAAAGAGGAAGG - Intronic
1128626312 15:69208965-69208987 CTGAACATACAGAAAGATTGGGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129808056 15:78481138-78481160 CTGTCCCTAGAGAAAGGGGATGG + Intronic
1129855449 15:78821438-78821460 CAGTCCAGACAGAAACAGGAAGG + Intronic
1129875273 15:78971195-78971217 TTGTACATCCAGAAACAGGCAGG - Intronic
1130616539 15:85414472-85414494 CTATACATACACAAAAATGAGGG + Intronic
1133391827 16:5416824-5416846 ATCTACATTCAGTAAGAGGAGGG + Intergenic
1133722868 16:8511277-8511299 CTGTAGCTACAGAAAGGGTAAGG + Intergenic
1135077630 16:19407731-19407753 GTTTCCACACAGAAAGAGGAGGG + Intergenic
1135336383 16:21605071-21605093 CTTTACATACAGAAAAGTGAGGG + Intronic
1135459494 16:22629045-22629067 CTGTGCTTACACAAAGAGGGAGG - Intergenic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1138909768 16:61382267-61382289 CTATTCATACAAAGAGAGGAAGG - Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1140932409 16:79640045-79640067 CTGAACACACAGAAAGTGGTAGG + Intergenic
1143614927 17:8044062-8044084 CTGTAAAGAGAGAAAGAGGTGGG + Intronic
1145206857 17:20989097-20989119 CTCTACATACAGAAGCAGGAGGG + Intergenic
1145289462 17:21531776-21531798 CAGTGCATCCAGAAAGAGGAAGG + Exonic
1145913580 17:28556879-28556901 CTGTACATTCAGGACAAGGATGG - Exonic
1146455254 17:33004665-33004687 CTGTACCTACAGGTAGAGAAGGG - Intergenic
1146616276 17:34359644-34359666 GTGGACATATAGGAAGAGGAGGG - Intergenic
1146784698 17:35709106-35709128 CTGCACTGAGAGAAAGAGGAAGG + Intronic
1146838417 17:36131672-36131694 CTGTTCATTGAGAAAGAGAAGGG - Intergenic
1147476046 17:40712339-40712361 CTCTACACACAGAAAGATAATGG - Intergenic
1148256698 17:46139818-46139840 CTGTCCTTAAAAAAAGAGGAAGG + Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149282600 17:55124883-55124905 TTGTACATGCACACAGAGGAGGG + Intronic
1149299789 17:55294546-55294568 CCTTACACACAGAAAGGGGAAGG - Intronic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1151063697 17:71126321-71126343 CTGCTCCTACAGAAAGAGAATGG - Intergenic
1151776500 17:76207056-76207078 GTGTATATACAGAAAGATGGTGG - Intronic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153969173 18:10209583-10209605 CTGTACATACAGAAAGAAGTGGG + Intergenic
1155633856 18:27927251-27927273 CTCTACCTACAGAAAAAGTATGG - Intergenic
1156627875 18:38931575-38931597 CTGCACCTCCAGAAAGAGGAGGG + Intergenic
1156996719 18:43477994-43478016 CTGTAACTACAGAAAGAAAAAGG - Intergenic
1159677291 18:71301272-71301294 CTGTAAATACATACAGAAGATGG - Intergenic
1159862052 18:73661042-73661064 CTGTACATACAAACAGATGATGG + Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160322851 18:77912595-77912617 CTGTGCATACAGAGAGACGGGGG - Intergenic
1163282823 19:16327424-16327446 CTGTACATAGAGAGACAGGTGGG + Exonic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1168674410 19:58266560-58266582 CGAAACATACAGAATGAGGAAGG + Intronic
925714544 2:6772382-6772404 CTGAACACAGAGACAGAGGAAGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927476221 2:23416351-23416373 CTGTCCATTCTGAGAGAGGAGGG - Intronic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
928650464 2:33398643-33398665 CTGGAAATACAGAAACAGCATGG + Exonic
929214828 2:39401200-39401222 CTATACAGACAGGAAGGGGAGGG + Intronic
929280623 2:40073981-40074003 CTGTATATACAGAAAGGTAAGGG + Intergenic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930970252 2:57386212-57386234 CTCTGCCTGCAGAAAGAGGAAGG + Intergenic
931078025 2:58738253-58738275 GTGTACATACAGAATGACAAAGG - Intergenic
931774569 2:65529600-65529622 CTGTACAGAAAGATAAAGGAGGG - Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
933787349 2:85854085-85854107 TTTTTCATAGAGAAAGAGGAAGG - Intronic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
937727163 2:125180878-125180900 ATGCACACACAGAGAGAGGAAGG - Intergenic
941257527 2:163252108-163252130 CTGTTCATACAGCACTAGGAAGG + Intergenic
941399804 2:165016735-165016757 ATGTATATTTAGAAAGAGGAAGG - Intergenic
941476715 2:165958439-165958461 ATCTACAGACAGAAAAAGGAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943393739 2:187305769-187305791 CCTTACCTAGAGAAAGAGGAAGG - Intergenic
943771254 2:191720297-191720319 CTGGACAGACAGAACGAGGCAGG + Intergenic
944890075 2:204108491-204108513 CTGTCCATTCATAAAGTGGAGGG + Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
946166196 2:217865432-217865454 ATGTGCAGACAGAGAGAGGAAGG + Intronic
1172883230 20:38215095-38215117 CTGGACACACAGACAGATGATGG - Intronic
1173267374 20:41496928-41496950 TTGTACCTATAGCAAGAGGAAGG - Intronic
1173277825 20:41599708-41599730 GTGTACAGAGAGAAAGACGAAGG - Intronic
1178072078 21:28979478-28979500 ATGTACATACAGGAACATGATGG + Intronic
1183771621 22:39931277-39931299 CTGGAAGTACAGAGAGAGGAAGG + Intronic
1185130235 22:49034883-49034905 CTGTGCATAGAGGAACAGGATGG + Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
950610390 3:14123241-14123263 CTGTAAATCCTCAAAGAGGAGGG + Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
952013783 3:28932926-28932948 CTGTACAACCAAAAAGATGATGG + Intergenic
955945381 3:64188716-64188738 CTTTACTTACAAAAACAGGAAGG - Intronic
956300587 3:67768421-67768443 CAGTACTTACAGAAAAAGTATGG - Intergenic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957269360 3:78009342-78009364 CAGTAGATACAGAAAGAAGTAGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
960440864 3:117686578-117686600 CAGTAAATACAGAAAGATAAGGG + Intergenic
960647142 3:119898663-119898685 CCGTATATACAGGAAGAGTAGGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
962150927 3:132892678-132892700 ATGTACATACAGAAACAGAGAGG + Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
965710944 3:171555652-171555674 TCGTACATCCAGAAAGAAGAAGG - Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966523856 3:180900264-180900286 CTTTCCACACAGGAAGAGGAGGG - Intronic
966992474 3:185247970-185247992 CAGTACCTACACAAAGAAGATGG - Intronic
967696902 3:192543242-192543264 CTGTGCTTACAGAAAAGGGAGGG - Intronic
967863245 3:194169366-194169388 CTGAACCCACAGAAAGAGAATGG - Intergenic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
971752556 4:30669067-30669089 TTATAAATACAGAAAGAAGATGG + Intergenic
971889877 4:32506822-32506844 TTGTGCATACAGCAAGAGTATGG + Intergenic
974987536 4:69046972-69046994 CTGTAGCTACTGAAACAGGATGG - Intronic
975081046 4:70280903-70280925 CTGTGCCTATGGAAAGAGGAAGG + Intergenic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
976358923 4:84154591-84154613 GTGTTCATATAGAAAGTGGATGG - Intergenic
976621528 4:87133069-87133091 CCATACATACAGAGAGAGAAAGG - Intronic
976936340 4:90639839-90639861 CTGTACATCCAGCAAGATCATGG + Intronic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
980634927 4:135489719-135489741 CTGTATTTACAGAAAGCAGACGG - Intergenic
980817877 4:137972164-137972186 CTGTGCATCCATAAAAAGGAAGG - Intergenic
980981179 4:139655761-139655783 CTGTAAATACTGTAAGAGCAGGG + Intergenic
981092148 4:140742956-140742978 ATGTACATACAGTATCAGGAAGG + Intronic
981546557 4:145899859-145899881 ATGTTCAAACTGAAAGAGGAGGG - Intronic
981831896 4:149011359-149011381 CAGAACAGACAGAAAGAAGAAGG + Intergenic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
985052100 4:186001092-186001114 CAGTGCTTACAGAAAGAGGGAGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987399958 5:17464450-17464472 CTAAAAATACAGAAATAGGAGGG - Intergenic
987466834 5:18282061-18282083 CTCTCCAGACAGAAGGAGGAGGG - Intergenic
987685405 5:21193147-21193169 GTGTATAGACAGAAAGAGGTTGG - Intergenic
988240914 5:28607409-28607431 ATGTACATACAAAAAGAAGAAGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988719834 5:33866203-33866225 CTATAGATACAAAAAGAGCATGG + Intronic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989212675 5:38871677-38871699 ATGTACATACAGATAGAGATAGG + Intronic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
992408527 5:76482521-76482543 TAGTACATACAGAAGGAAGAGGG + Intronic
992553819 5:77884416-77884438 CTGTATATACAGAGTGAGAAAGG + Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
993316068 5:86407922-86407944 GTGTACATGCAGAGACAGGAAGG + Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
994927205 5:106132205-106132227 CTTAACATAAAGAAAGAAGAAGG + Intergenic
994949204 5:106435313-106435335 CTGTCTTTACAGAAAGAAGAAGG - Intergenic
995076506 5:107991131-107991153 CTGTACCTCCAGAAAGATAAAGG + Intronic
995353861 5:111214778-111214800 CTGGGCATACAAAAAAAGGATGG - Intergenic
995750869 5:115452060-115452082 CTGTACAGACACAGAGAGGTGGG - Intergenic
996098879 5:119427705-119427727 AAGTACTTACAGAAACAGGAAGG - Intergenic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998520327 5:142794361-142794383 CTATAAATACAGAAGGAGGGGGG + Intronic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
1000831328 5:166104451-166104473 CTGTACATAGTGAAAAATGAAGG + Intergenic
1001114554 5:168928580-168928602 TTGCACATACACAAAGAGGCAGG - Intronic
1001943302 5:175756049-175756071 TTGTTCTTACAGGAAGAGGAGGG - Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003963094 6:11227647-11227669 CTCTACATACAAATAGAGGGTGG + Intronic
1004170263 6:13290378-13290400 TTGTACATACAGAAACTGCATGG + Exonic
1005172882 6:23008482-23008504 CTGTAAATTCAGTGAGAGGAAGG - Intergenic
1006654716 6:35581087-35581109 CTGTACTTACAAAAACAGGCAGG + Intronic
1006697391 6:35942613-35942635 TTGTAAATACAAAAAGAGGTAGG - Intergenic
1008211166 6:48727420-48727442 ACCTACATTCAGAAAGAGGAGGG + Intergenic
1009618564 6:66042487-66042509 CTCTTCATACAGAAAGAAAAGGG - Intergenic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1012146057 6:95683226-95683248 ATGCACTTACAGAAAGAGCAAGG + Intergenic
1012272330 6:97229184-97229206 CTGGGCATACATCAAGAGGAAGG + Exonic
1013150279 6:107439123-107439145 CTGTACAGGAAGAAAGTGGAGGG - Intronic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1015864108 6:137710599-137710621 GTATACACACAGGAAGAGGAAGG + Intergenic
1016090233 6:139969117-139969139 GTGAACATACACAAAGAAGACGG - Intergenic
1017687668 6:156929326-156929348 ATCTACACACAGAAAGTGGAGGG + Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019944991 7:4320575-4320597 CTGTAGAGACAGAAAATGGAAGG - Intergenic
1020711012 7:11605161-11605183 ATGTACATATAGAGAGAGGAGGG - Intronic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1021546359 7:21817331-21817353 CTCTACATATAAAAAGAGGATGG - Intronic
1022243815 7:28537875-28537897 CTGTACATCAAGATAGAGTAAGG - Intronic
1022873898 7:34507966-34507988 CTGAACTTAGAGAAAGAGGTTGG - Intergenic
1023140381 7:37096042-37096064 GAGTACATACAGAAAAAGAAAGG - Intronic
1023314029 7:38916862-38916884 TTATACATAAAGAAAGAGTATGG + Intronic
1023682985 7:42706788-42706810 CGCTACAGACAGGAAGAGGAGGG + Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024617108 7:51125238-51125260 CTGTACTTATAAGAAGAGGAAGG + Intronic
1024674523 7:51626237-51626259 CTGTGAATACACCAAGAGGAAGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027185343 7:75967750-75967772 CGGTCCATACAGAGGGAGGAGGG + Intronic
1028566353 7:92236070-92236092 CTGTTCTTACAGAAAGACAAAGG + Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1030204138 7:106936412-106936434 ATGTTCATATAGAAAGAGAAAGG + Intergenic
1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG + Intergenic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032545452 7:132737938-132737960 ATGTACACAAAGAAATAGGAGGG - Intergenic
1032918972 7:136524773-136524795 ATGTAAATACAGAAAAGGGATGG + Intergenic
1033636603 7:143217880-143217902 CTGCACATATAGAAAGATTAGGG + Intergenic
1034851117 7:154494926-154494948 CTCGAGATACAGACAGAGGAGGG + Intronic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037776997 8:21842105-21842127 CTGGACATACAGAGATAAGAAGG - Intergenic
1038172761 8:25152598-25152620 ATGTACATACAGAGAAAGAAAGG + Intergenic
1039966211 8:42285868-42285890 CCGTAGAGACAGAAAGAGGTGGG + Intronic
1041942125 8:63399947-63399969 ATGTCCTTCCAGAAAGAGGAAGG + Intergenic
1042479709 8:69289721-69289743 CTGAACATACACAAAGAAAATGG - Intergenic
1043520503 8:81040132-81040154 ATGTACATAGAGAAACAGGGTGG - Intronic
1044431231 8:92109629-92109651 CTCTGCATATAGAAGGAGGATGG - Intergenic
1045600730 8:103712709-103712731 CTGTAGATACAGAAACACAAAGG + Intronic
1045748602 8:105454753-105454775 CTGTTCATAAAGAAAGGGGAGGG + Intronic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046480464 8:114810392-114810414 AGGTACATACACCAAGAGGAGGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1047318899 8:123760494-123760516 CTGTAAATAAGGGAAGAGGATGG - Intergenic
1048476739 8:134749651-134749673 TTTTACATACAGTATGAGGAAGG + Intergenic
1049153661 8:141053978-141054000 CTGCAAATACACAAACAGGATGG + Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG + Intergenic
1055100035 9:72454441-72454463 CTTTACAAACTGAAAAAGGAAGG - Intergenic
1056898286 9:90572255-90572277 ATGTACATACATAAAGAGGAAGG + Intergenic
1058109195 9:101012866-101012888 TTCTACATAGAGAAAGATGAAGG + Intergenic
1059297929 9:113288839-113288861 CTGAACTTACAGAACCAGGAAGG - Intronic
1059311427 9:113391198-113391220 CAATACAAACAGAAAAAGGAAGG - Intronic
1061609699 9:131738572-131738594 CTGTCCAGACAGCAAGAGGGCGG - Intronic
1186642765 X:11473462-11473484 GTGTCCTTACAGAAAAAGGAGGG + Intronic
1188068305 X:25688387-25688409 ATGTACATACAAAATGAGGCTGG + Intergenic
1189592327 X:42527597-42527619 ATTTATATACAGAAAGAGAATGG - Intergenic
1190477239 X:50840198-50840220 CTGTGCCTGCAGAGAGAGGAAGG - Intergenic
1190888577 X:54550429-54550451 GAGCACATACAGAAAGAGAACGG + Intronic
1194764469 X:97833459-97833481 TTGTACAAAAAGAAACAGGAAGG - Intergenic
1195743421 X:108090126-108090148 TTTTACATACTGAAAGAGAAGGG - Intronic
1196757078 X:119167450-119167472 GTGTAGCTACAGCAAGAGGATGG + Intergenic
1197271663 X:124431061-124431083 TTGTACATACTGGAAGATGAAGG - Intronic
1197324167 X:125070975-125070997 CTCTTCAAACAGAAAGAAGATGG + Intergenic
1198166808 X:134065681-134065703 CTATACATCAATAAAGAGGAAGG - Intergenic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1200711594 Y:6489614-6489636 ATGTACTTACAGAATCAGGAAGG + Intergenic
1201022339 Y:9672365-9672387 ATGTACTTACAGAATCAGGAAGG - Intergenic
1202074411 Y:21023966-21023988 AAGTACATACAGAATCAGGAAGG - Intergenic
1202084336 Y:21120047-21120069 CTGTACATACAAAATGAGAATGG + Intergenic