ID: 992609621

View in Genome Browser
Species Human (GRCh38)
Location 5:78495943-78495965
Sequence AGGGGGTCACTGTGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992609621_992609628 -3 Left 992609621 5:78495943-78495965 CCTGTTATTCACAGTGACCCCCT 0: 1
1: 0
2: 1
3: 11
4: 104
Right 992609628 5:78495963-78495985 CCTTGGACGCTCACGCATCTGGG No data
992609621_992609626 -4 Left 992609621 5:78495943-78495965 CCTGTTATTCACAGTGACCCCCT 0: 1
1: 0
2: 1
3: 11
4: 104
Right 992609626 5:78495962-78495984 CCCTTGGACGCTCACGCATCTGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992609621 Original CRISPR AGGGGGTCACTGTGAATAAC AGG (reversed) Intronic
907245055 1:53103220-53103242 AGAGGTTTACTGTGAAAAACTGG - Intronic
909587717 1:77309416-77309438 AGCAGATCACTGTGAAAAACAGG - Intronic
913063764 1:115231196-115231218 CAGGGGACACTGTGAATAAGAGG + Intergenic
921302792 1:213766567-213766589 AGGAGGTCATTGAGAAGAACAGG - Intergenic
923427268 1:233883612-233883634 AGGGAGTCTGCGTGAATAACAGG - Intergenic
1065223561 10:23520492-23520514 AGGGGGTGACTGTGAGTGGCAGG - Intergenic
1068934990 10:62627009-62627031 ATGGGGTGACTGTGACTAAGGGG - Intronic
1069172484 10:65250761-65250783 AGAGGATCACTGGGAATAAGCGG - Intergenic
1077856440 11:6130981-6131003 GTGGGGTCACTGTTAAAAACAGG - Intergenic
1081411773 11:42767355-42767377 AGTGGGTAAATGTGAATTACTGG - Intergenic
1081573066 11:44303428-44303450 AGGGGGTCACTGGGAGATACGGG - Intronic
1083734950 11:64674856-64674878 ATGGGGTCAGTGTGAAGATCAGG - Intronic
1084675723 11:70632921-70632943 AGGGGCTCACTGGGATTAAAGGG - Intronic
1085050760 11:73379040-73379062 AAGGGGTCTCTGGGAAGAACAGG - Intronic
1086063738 11:82725784-82725806 AGGGGGTCTCTTTGTATAATAGG + Intergenic
1089574502 11:119431958-119431980 TGGGGGTCACTGGGAAGCACTGG + Intergenic
1101114858 12:101522125-101522147 AAGGGGTCACAGTGAAGAAGGGG + Intergenic
1102207409 12:111099785-111099807 AGAGGGTCACTCTGAATGATGGG - Intronic
1103526956 12:121575501-121575523 AGGAGGTCACTGAGTGTAACTGG + Intronic
1105039674 12:132953039-132953061 AGGTGGTCACTGTGAGTGACTGG - Intronic
1106088614 13:26565606-26565628 AGGGGGTTACTGTGTATTTCTGG - Intronic
1106301010 13:28465427-28465449 AAGAGGTTACTGTCAATAACAGG + Intronic
1107814899 13:44235883-44235905 TGTGGGTCACTATGAAAAACAGG - Intergenic
1108718146 13:53102759-53102781 AGGGTGTCAGTCAGAATAACAGG + Intergenic
1113636643 13:111923438-111923460 AGGGGTTCACTGGGAAGAGCAGG + Intergenic
1123030939 14:105450709-105450731 TGGGGGTCACTGTGATTATACGG + Intronic
1123115845 14:105893703-105893725 AGGGGGACACTGTGCATGTCTGG - Intergenic
1123120087 14:105912418-105912440 AGGGGGACACTGTGCATGTCTGG - Intergenic
1123402825 15:20004004-20004026 AGGGGGACACTGTGCATGTCTGG - Intergenic
1123512162 15:21010658-21010680 AGGGGGACACTGTGCATGTCTGG - Intergenic
1123788001 15:23691443-23691465 GAGGGGAGACTGTGAATAACAGG + Intergenic
1131401745 15:92130938-92130960 AGGGGATCACTGTGAAAAGGAGG - Intronic
1134172251 16:11977414-11977436 AGTGGGTAACTGGGAAGAACTGG - Intronic
1135826396 16:25732511-25732533 GGGGTGTCACTGTGAAAAGCTGG - Intronic
1136288409 16:29257662-29257684 CAGGGGTCACTGTGGGTAACTGG + Intergenic
1142094089 16:88230445-88230467 CAGGGGTCACTGTGGGTAACTGG + Intergenic
1142769438 17:2086015-2086037 AGGGGGTCAGAATGAATGACGGG + Intronic
1146601310 17:34219219-34219241 AGGTGGTCACCTTCAATAACAGG + Intergenic
1150745117 17:67810481-67810503 AAGTGGTCAATGTGAAGAACTGG - Intergenic
1152592114 17:81218812-81218834 AGGGTTCCACTGTGAATAAAAGG - Intronic
1155122077 18:22831493-22831515 CGTGGGTCACTGTGCATAAAAGG - Intronic
1156138106 18:34069713-34069735 AGCGGGTTACTGTGGATAATGGG - Intronic
1159012487 18:63071207-63071229 CGGGGGTCAGTGTGACTCACAGG - Intergenic
1162458803 19:10802254-10802276 CGGGGGTCACTGTGAGTACAAGG - Intronic
1162552518 19:11365497-11365519 TGGGGGGCAGTGTGAAGAACAGG - Exonic
1167114957 19:47483797-47483819 AGGGGGTCACTGGGATCAGCGGG - Intronic
1168592486 19:57648958-57648980 AGTGGGTCATCTTGAATAACTGG - Intergenic
925734326 2:6948047-6948069 AGGAGGTCAGTGTGTATAACTGG + Intronic
931329593 2:61266899-61266921 AGTGGCTCACTGTGCCTAACGGG + Intronic
938547915 2:132352349-132352371 AGGGGTTCAATGTGGAAAACGGG - Intergenic
940536484 2:154951676-154951698 AGAGGTTCACTGTTATTAACAGG + Intergenic
948678202 2:239611509-239611531 AGGGTGTCACTGTGAGAATCAGG + Intergenic
1169870714 20:10245324-10245346 AGGGTGTCTCTTTCAATAACTGG + Intronic
1170746635 20:19105363-19105385 AGGAGGTCACTTTGAAGAATGGG + Intergenic
1171876783 20:30585122-30585144 AGGGGTTCAGTGTGGAAAACGGG - Intergenic
1174172233 20:48624784-48624806 AGAGGGTCACTGGGAAACACCGG - Exonic
1175665621 20:60857362-60857384 AGGTGGTCACTTTGAAGAAGAGG + Intergenic
1183159604 22:36103419-36103441 AGGGGGCAGCTGTGAATAACAGG + Intergenic
951467256 3:23014626-23014648 AGTGGGTCAGTGGGGATAACTGG - Intergenic
953144892 3:40266170-40266192 AGGCTGTCACTGTGGGTAACTGG - Intergenic
953928857 3:46996187-46996209 TGGGGGTCACTGTGAGGAACTGG + Intronic
955717702 3:61847790-61847812 AGGAAGTCTCTGTGAATATCTGG - Intronic
955894143 3:63681088-63681110 AGGAAGTCATTGTGAAGAACAGG - Intergenic
956391377 3:68776274-68776296 AGAGGTTCACTGTGAGAAACAGG + Intronic
956530855 3:70216897-70216919 AAGGGGTCCCTGTGCATAATAGG - Intergenic
963892618 3:150652670-150652692 AGGAGGCCACTGTGCATGACAGG - Intergenic
964291507 3:155185976-155185998 ATGGGGTGAGTGTGAATAACTGG + Intergenic
969102205 4:4777635-4777657 AGGGGGTAACAGTGAATAGCTGG + Intergenic
969306048 4:6326887-6326909 AGGGGGTCACCAGGAATAAGAGG + Intronic
970135031 4:12913000-12913022 AGGGGGTCAGTGTTCAGAACTGG + Intergenic
970518424 4:16858439-16858461 AGTGAGTCACTGTGACTAAGAGG + Intronic
972115194 4:35622917-35622939 AGTGGGTCACTGGAAATAATGGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
977889100 4:102287007-102287029 AGGGAGTCACTGTACTTAACTGG + Intronic
984604695 4:181771500-181771522 AGGGGGTCAATGTCAATGATGGG + Intergenic
984706288 4:182849444-182849466 AGGTGGTGACTGTGACAAACTGG + Intergenic
986111871 5:4727177-4727199 AGGGTGTCACTATGAATAATAGG - Intergenic
986194314 5:5524147-5524169 AGAAGGTCACTGTGAAGAATGGG - Intergenic
987230872 5:15892247-15892269 AGGGGGTCCCTGTGAGCAAGAGG + Intronic
989319368 5:40117199-40117221 AGGGGGTCACACTGAGGAACAGG - Intergenic
992609621 5:78495943-78495965 AGGGGGTCACTGTGAATAACAGG - Intronic
993908893 5:93656357-93656379 ATTGGGTTACTGAGAATAACAGG - Intronic
994122569 5:96133451-96133473 AGGGTGTCACAGTGAATCAGGGG - Intergenic
995034535 5:107518347-107518369 TGGAGGTCACTGTGATTGACAGG + Intronic
996791550 5:127298703-127298725 AGGGGGTCACAGAGAATAGCTGG + Intronic
1005692423 6:28320393-28320415 ATTGGGTCACTGATAATAACAGG - Intergenic
1007444680 6:41895572-41895594 AGGGGGACGTTGTGAATAGCTGG + Intergenic
1014586843 6:123208497-123208519 AGTAGGTCATTTTGAATAACAGG - Intergenic
1015392085 6:132694062-132694084 AGGGGGACACTGAGGATCACTGG + Exonic
1015395446 6:132728813-132728835 AGGGGGACACTGAGAGTCACTGG + Exonic
1016603669 6:145892425-145892447 AGGAGGTCACTGTGTAGTACAGG - Intronic
1017045257 6:150341288-150341310 AGGTGGTCAATGTGAAAGACGGG - Intergenic
1018203597 6:161416587-161416609 CGGGGGTCACTGGTAAGAACGGG - Intronic
1018577425 6:165274281-165274303 AGGGGGCCCCTGTGAATATGGGG + Intergenic
1019462953 7:1170951-1170973 AGGGGGTCCCTGGGAAACACAGG + Intergenic
1021423735 7:20474571-20474593 AGGAGGTCACTGTGGAGCACAGG + Intergenic
1022815882 7:33913850-33913872 AGGGTGTCACTGAGAGTAAGAGG - Intronic
1023465682 7:40451914-40451936 AGGGGCTCACTGTGAAGAACTGG - Intronic
1024216389 7:47252750-47252772 AGTGGGTCCCTGTGAATCACAGG + Intergenic
1027154370 7:75756188-75756210 AAGGGGTCACTGTGACAAAGAGG - Intergenic
1029682879 7:102124248-102124270 TGGGGGTCAGGGTGGATAACGGG + Intronic
1032260199 7:130329625-130329647 AGGGGGTCACTGGGTTTTACAGG + Intergenic
1036224136 8:6943921-6943943 AGGGGTTCACACTGAATCACAGG + Intergenic
1036661156 8:10709979-10710001 ACTGGGTCACTGTGAATGGCTGG - Intronic
1038704227 8:29878962-29878984 AGGGGACCACTGTGAGTAACGGG - Intergenic
1039146492 8:34452679-34452701 AGGAGGTCACAGTGAATTAGGGG - Intergenic
1041801524 8:61805637-61805659 AGGGAGTCACTGGCAATAAATGG - Intergenic
1050696526 9:8285657-8285679 AGGCGGTCACTGTTAATGAGAGG - Intergenic
1050846072 9:10220986-10221008 AGAAGGTCACTGTGAACAGCAGG + Intronic
1052152947 9:25142158-25142180 AGGTGGTTACTGTGAATGACAGG + Intergenic
1057897878 9:98924327-98924349 AGGGGTTCCCTGTGGCTAACAGG - Intergenic
1058620282 9:106875736-106875758 AGTGTGACACTGTGAATCACTGG + Intronic
1060545570 9:124457272-124457294 AGGGGGTCACTGAGAAGGAGGGG - Intronic
1194475124 X:94348832-94348854 AGTGGGTCACTGGGAGTGACAGG - Intergenic
1200528023 Y:4297421-4297443 AGGGGGTCACTGGTAGTAAAAGG - Intergenic
1200705775 Y:6441279-6441301 AGGGGCTCATTGTGAAAGACAGG + Intergenic
1201028336 Y:9723429-9723451 AGGGGCTCATTGTGAAAGACAGG - Intergenic