ID: 992610213

View in Genome Browser
Species Human (GRCh38)
Location 5:78501410-78501432
Sequence CTGGCTGAGGGCCCTTCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992610206_992610213 21 Left 992610206 5:78501366-78501388 CCTTAGCACAGAGTGGACCAGCA 0: 1
1: 1
2: 0
3: 12
4: 132
Right 992610213 5:78501410-78501432 CTGGCTGAGGGCCCTTCTGCGGG No data
992610208_992610213 4 Left 992610208 5:78501383-78501405 CCAGCACTCGTTCAAAGGAAGCA 0: 1
1: 0
2: 0
3: 6
4: 63
Right 992610213 5:78501410-78501432 CTGGCTGAGGGCCCTTCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992610213 Original CRISPR CTGGCTGAGGGCCCTTCTGC GGG Intronic
No off target data available for this crispr