ID: 992610659

View in Genome Browser
Species Human (GRCh38)
Location 5:78505453-78505475
Sequence GTGTGTCAGGGGAAGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1348
Summary {0: 1, 1: 0, 2: 14, 3: 123, 4: 1210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992610650_992610659 3 Left 992610650 5:78505427-78505449 CCAGAAAGAGAAGGAATGGAAAA 0: 1
1: 1
2: 18
3: 129
4: 855
Right 992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG 0: 1
1: 0
2: 14
3: 123
4: 1210
992610649_992610659 6 Left 992610649 5:78505424-78505446 CCTCCAGAAAGAGAAGGAATGGA 0: 1
1: 0
2: 3
3: 56
4: 371
Right 992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG 0: 1
1: 0
2: 14
3: 123
4: 1210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992610659 Original CRISPR GTGTGTCAGGGGAAGGGGAG GGG Intronic
900120328 1:1046096-1046118 GTGTGGGATGTGAAGGGGAGTGG + Intronic
900204845 1:1427438-1427460 GTGATGGAGGGGAAGGGGAGGGG - Intronic
900315123 1:2052478-2052500 GTGTGGCAGGGAAGGGAGAGAGG - Intronic
900470803 1:2854045-2854067 GTCTGGCAGGTGACGGGGAGGGG + Intergenic
900510119 1:3054931-3054953 GGGTGCCAGGGGCTGGGGAGGGG + Intergenic
900813231 1:4824120-4824142 GTGGGGCAGGGGTAGGGGATGGG + Intergenic
901386894 1:8916263-8916285 GGTTGTCAAGGGATGGGGAGGGG + Intergenic
901425563 1:9180684-9180706 GTGTGCCAAGGGCAGGGGTGGGG + Intergenic
901592189 1:10353800-10353822 GTATGTCTGGGGAGGGGGAGTGG + Intronic
901642615 1:10700552-10700574 GTGTGTCAGGGGTGGGGTGGGGG + Intronic
901857597 1:12054236-12054258 GTGTAACTGGGGTAGGGGAGCGG + Intergenic
902543896 1:17174157-17174179 GTGGCCCAGGGGTAGGGGAGGGG - Intergenic
902557509 1:17255626-17255648 GTGTGTTAGGAGAATGAGAGGGG - Intronic
902658396 1:17885154-17885176 GTGTGTTAATGGAGGGGGAGAGG + Intergenic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902776199 1:18676482-18676504 GAGTGGCTGGGGGAGGGGAGGGG + Intronic
902873313 1:19326865-19326887 GGAGGTCAGGGGAAGGTGAGGGG + Intronic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903288332 1:22291033-22291055 GGGAGTCGGGGGATGGGGAGGGG - Intergenic
903496697 1:23773233-23773255 CCGAGTCAGGGGCAGGGGAGGGG + Intergenic
903679779 1:25089186-25089208 GTGTGTCAGAGCAAGTGGGGAGG + Intergenic
903904191 1:26672142-26672164 TTGTGTGAGGAGGAGGGGAGTGG - Intergenic
904024385 1:27493039-27493061 GAATGTCAGGGGATGGGGTGGGG + Intergenic
904024900 1:27496712-27496734 GGGGGTCAGGGAGAGGGGAGGGG - Intergenic
904131898 1:28281589-28281611 GTGTGTGAGAGGAGGAGGAGAGG + Exonic
904266036 1:29319041-29319063 GGGTGTCAGCTGAAGGGGAGGGG + Intronic
904345239 1:29863772-29863794 GTGTGGGAAGGGAAGGGGTGGGG + Intergenic
904490534 1:30856204-30856226 CTGTCTCAGGGGAAGGGTTGAGG - Intergenic
904592934 1:31625356-31625378 GTGAGTGAGTGGAAGGGCAGGGG + Intronic
904806127 1:33133673-33133695 GGGTGTTAGGGCAAGGGCAGTGG + Intergenic
905068267 1:35202586-35202608 TTGTGTTGGGGGATGGGGAGAGG + Intergenic
905238361 1:36565948-36565970 GTGGGGCGGGGCAAGGGGAGGGG - Intergenic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
905557350 1:38897706-38897728 GTGTGTGGGGGTGAGGGGAGAGG - Intronic
905871405 1:41406578-41406600 GGGGGGCAGTGGAAGGGGAGAGG - Intergenic
906246400 1:44277644-44277666 GTGTTTCAGAAGAAGAGGAGTGG - Intronic
906540506 1:46582172-46582194 GTGTGTCAGGGTATGGGGATGGG - Intronic
906649524 1:47502942-47502964 GCAGGTCAGGGGCAGGGGAGTGG - Intergenic
906659310 1:47571367-47571389 GGGAGGCAGGGGCAGGGGAGAGG - Intergenic
906675182 1:47688270-47688292 TTGTGCCAGGGGATGAGGAGAGG - Intergenic
906680095 1:47720434-47720456 GAGGGACAGGGGGAGGGGAGAGG - Intergenic
906704480 1:47885002-47885024 GGGTGGCAGGGGAAGGGGAGGGG - Intronic
907032201 1:51183550-51183572 GTGTATTTGGGGAAGGGGAAGGG + Intergenic
907621323 1:55983542-55983564 GGGAGTAAGGGGGAGGGGAGGGG + Intergenic
907669094 1:56459000-56459022 TTGAGTCAGTGGAATGGGAGAGG + Intergenic
908477659 1:64505586-64505608 GTGTGCCCAGGGAGGGGGAGGGG - Intronic
908481485 1:64544516-64544538 GTGGGTCAGTGGATGGAGAGAGG + Intronic
908514860 1:64882177-64882199 GAGTTTCAGGAAAAGGGGAGAGG - Intronic
910404169 1:86868556-86868578 GAGGGAGAGGGGAAGGGGAGAGG + Intronic
910631971 1:89364649-89364671 GTGTGTGTGGGGAGGGGGTGGGG + Intronic
911102755 1:94107132-94107154 GTCTACCAGGGGAATGGGAGAGG - Intronic
911790313 1:102006698-102006720 TAGTGTGAGGGGTAGGGGAGAGG - Intergenic
911820335 1:102411297-102411319 GAGGGACAGGGGAGGGGGAGGGG + Intergenic
911884927 1:103286417-103286439 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
912195499 1:107392518-107392540 GAGTGTCAGGGGAGAGGGAGTGG + Intronic
912799728 1:112713468-112713490 GTGTCTCTGGGAAAGGGGATGGG + Intronic
912829543 1:112939890-112939912 TTGTGCCAGGGGATGGGCAGGGG - Intronic
913450761 1:118991030-118991052 GTGTGTCTGTGGAATGGGGGTGG - Intergenic
914322184 1:146575880-146575902 GAGTGTCAGGGGAGGTGAAGTGG - Intergenic
914411167 1:147429082-147429104 GTGGGGTGGGGGAAGGGGAGAGG + Intergenic
914496009 1:148198213-148198235 GAAGGTGAGGGGAAGGGGAGGGG - Intergenic
914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG + Intronic
915143910 1:153783506-153783528 GTGAGCCCCGGGAAGGGGAGGGG + Intergenic
915147960 1:153806496-153806518 GGGTTTCTGGGGAAGGGGAGGGG - Exonic
915534611 1:156527755-156527777 CTGTGTCAGGGCATGGGGAAAGG + Intronic
915598665 1:156909111-156909133 GTGGGCCAAGGGCAGGGGAGCGG + Intronic
915721260 1:157987591-157987613 GTGTGTGGGGGGGAGGGCAGTGG - Intergenic
916206660 1:162321568-162321590 GTGGGGTAGGGGTAGGGGAGAGG + Intronic
916325724 1:163557647-163557669 GTGTGGCAGAGGACGGGGAGTGG - Intergenic
916705736 1:167347695-167347717 GGTTGTCAGGGGCTGGGGAGAGG - Intronic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
917525673 1:175786305-175786327 GTGTGTCATGGGAAGAAGAGAGG - Intergenic
917684115 1:177398549-177398571 GTGTGTCTGTGGGAGGGGACAGG - Intergenic
917779182 1:178373467-178373489 ATGTGTCAGGGGAGGGGAATGGG - Intronic
918097126 1:181344920-181344942 GTGGGGCAGGGGAAGGGATGTGG - Intergenic
918498408 1:185165714-185165736 GAGTGTCAGGGGGATGGGATGGG - Intronic
919012733 1:191986287-191986309 TTGTGGCTGGGGAAGGGGTGGGG - Intergenic
919805039 1:201376493-201376515 GGGGGTAAGGGGATGGGGAGAGG + Intronic
919897527 1:202018497-202018519 GTGTGTCCTGGGCTGGGGAGTGG + Intergenic
919943791 1:202305750-202305772 GTGAGTCTGGGGTAGGGAAGAGG + Intronic
919966345 1:202530326-202530348 GTTTGTCACGGGGAGGGGAAGGG - Intronic
919974787 1:202603358-202603380 GTGTCTCAGAGGCAGGAGAGTGG - Intronic
920048040 1:203146154-203146176 CAGTGTCAGGGGTGGGGGAGGGG + Intronic
920211997 1:204335214-204335236 GTGTGTGGGGGGAAGTGGTGGGG - Intronic
920439879 1:205972782-205972804 GTGTGTGATGGGGTGGGGAGTGG - Intergenic
920543077 1:206793898-206793920 GAGTAGCAGGGGAAGGAGAGTGG + Intergenic
920819762 1:209369391-209369413 GGGTGGGATGGGAAGGGGAGGGG + Intergenic
921324937 1:213980357-213980379 GTGTGGGAGGGGCAAGGGAGTGG - Intergenic
921435052 1:215108832-215108854 GTGTGTGAGGGGTTGGGGAGAGG + Intronic
923017948 1:230141452-230141474 GGTTGCCAGGGGGAGGGGAGGGG - Intronic
923092653 1:230751855-230751877 GTGGGGGAGGGGAGGGGGAGGGG + Intronic
923099458 1:230800839-230800861 ATGGGTCAGGGGAAAAGGAGAGG - Intronic
923134595 1:231107073-231107095 TGGTGACAGGGGAAGGAGAGTGG - Intergenic
923255051 1:232214655-232214677 TTGTGTCAGGGGATGGGACGGGG + Intergenic
923391911 1:233520716-233520738 GTGAGTCAGTGGAAAGGCAGGGG + Intergenic
923451216 1:234119157-234119179 GTGTGTAAGGGTAAGAGAAGGGG + Intronic
923871268 1:237996497-237996519 GTGTGTTTGGGGAATGGGAGGGG + Intergenic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
924424032 1:243934041-243934063 GGATGGGAGGGGAAGGGGAGGGG - Intergenic
924436534 1:244048513-244048535 GGGAGGCAGGGGAAGGAGAGGGG + Intergenic
924527124 1:244863224-244863246 ATGTCTCGGGGGGAGGGGAGAGG - Intronic
924615288 1:245607264-245607286 GTGTGTCAGCAGAGGGTGAGTGG + Intronic
924821436 1:247494579-247494601 GAGTTTCAGGGTATGGGGAGAGG + Intergenic
1062784894 10:256190-256212 GTGAGGCAGGGGAAGGTGATGGG - Intergenic
1062795497 10:341991-342013 TTGTGTCTGGGGAATGTGAGTGG + Intronic
1063410448 10:5833022-5833044 GGGTGGCAGGGGTGGGGGAGCGG - Intronic
1063723454 10:8609820-8609842 GCCTGTCAGGGGATGGGGGGTGG + Intergenic
1063765759 10:9138339-9138361 GTGTGTGGGGGGCAGAGGAGGGG - Intergenic
1063791326 10:9451526-9451548 GCGTGCCAGGGAAAGGAGAGTGG - Intergenic
1063945248 10:11169746-11169768 GTCTGTCATGGGAATGGAAGGGG + Intronic
1064546101 10:16451282-16451304 TTGAGTCAGTGGACGGGGAGTGG - Intronic
1064769756 10:18711371-18711393 GTGTGTAGAGGGAGGGGGAGGGG - Intergenic
1064783624 10:18869912-18869934 TTGAGTCAGTGGACGGGGAGAGG + Intergenic
1065146335 10:22772002-22772024 GCCTGTCGGGGGATGGGGAGGGG + Intergenic
1065502621 10:26397159-26397181 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
1065656150 10:27952546-27952568 GCCTGTCAGGGAAAGGGGATGGG - Intronic
1066122546 10:32303625-32303647 GATGGTCAGGGGATGGGGAGAGG + Intronic
1066129631 10:32380081-32380103 GTGTGTGTGGGGAGGGGAAGAGG - Intergenic
1066378959 10:34885192-34885214 GTGTGGGAGGTGAAGGAGAGAGG + Intergenic
1066427244 10:35318864-35318886 ACGTCTCAAGGGAAGGGGAGGGG - Intronic
1066952329 10:42133143-42133165 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
1067039145 10:42939826-42939848 GGGTGGCACGGGAAGGAGAGAGG + Intergenic
1067161320 10:43826949-43826971 GGGCGTGAGGGGAAGCGGAGGGG + Intergenic
1067168239 10:43882436-43882458 GGGAGTAAGGGGCAGGGGAGAGG - Intergenic
1067460478 10:46454580-46454602 GTGGGTGAGGGGAAGGGTAGTGG + Intergenic
1067477761 10:46578002-46578024 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
1067626714 10:47930023-47930045 GTGGGTGAGGGGAAGGGTAGTGG - Intergenic
1067832597 10:49618989-49619011 GGGTGTTAGGGGCAGGGGTGGGG - Intronic
1068423425 10:56823980-56824002 GTGTCTCTGGTGAAGGGCAGGGG - Intergenic
1068913702 10:62406043-62406065 GTGGGTAAGGGCAAGAGGAGTGG + Intronic
1069614416 10:69797846-69797868 GAGTGTGAGGTGGAGGGGAGGGG + Intergenic
1069958986 10:72068582-72068604 GGGTGACAGGGGCAGGGGAGGGG - Intronic
1069958995 10:72068602-72068624 GGGCGACAGGGGCAGGGGAGGGG - Intronic
1070225364 10:74498668-74498690 GTGGGCTGGGGGAAGGGGAGAGG - Intronic
1070307393 10:75247891-75247913 GTGTTCCTGGGGCAGGGGAGGGG - Intergenic
1070456071 10:76618892-76618914 GTAGGTTAGGGGATGGGGAGAGG + Intergenic
1070531526 10:77341613-77341635 GCCTGTGATGGGAAGGGGAGGGG + Intronic
1070729625 10:78817435-78817457 GTAAGACAGGGGAAGGGGATGGG + Intergenic
1070810051 10:79293138-79293160 GGGTGTTAGGGGATGGGGTGGGG - Intronic
1070871488 10:79757796-79757818 TTGTTTCAGGGGAAGGAGGGAGG + Intergenic
1070890431 10:79938927-79938949 GTGAGTGAGGCGCAGGGGAGTGG + Intronic
1070979019 10:80629563-80629585 GTGTGTCAGGGGTTGTGGTGGGG + Intronic
1070988329 10:80707999-80708021 GGATGTCAGGGGTAGGGGGGCGG - Intergenic
1071374323 10:84987084-84987106 GTGGGTCAGTGGACTGGGAGAGG - Intergenic
1071374489 10:84988714-84988736 GTGAGGCTGGGGAAGGGAAGGGG - Intergenic
1071483724 10:86083944-86083966 GTGTCCCAAGGGAAGGGGCGAGG + Intronic
1071559266 10:86632533-86632555 GTGTGTGGGGGGATGGGGAATGG - Intergenic
1072210950 10:93246672-93246694 GTGTGTCTGGGGCAGAGGTGGGG + Intergenic
1072430810 10:95369211-95369233 GTGGAACAGGAGAAGGGGAGAGG - Intronic
1072468250 10:95687569-95687591 GTGAGCCTGGGGAAGGGGATGGG - Intronic
1072837063 10:98726484-98726506 GTGGGGCAGGGGGAGGGGGGAGG + Intronic
1072909910 10:99491178-99491200 CTGTGTCAGGGGAGGGGTTGGGG - Intergenic
1073015030 10:100391841-100391863 GTATGGCAGGGGTTGGGGAGTGG - Intergenic
1073215848 10:101835671-101835693 GTGTGTAAAGGGGTGGGGAGAGG + Intronic
1073345059 10:102776713-102776735 ATGGGGCTGGGGAAGGGGAGAGG + Intronic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1073589250 10:104740732-104740754 GTGTGTCAAGGCAAGGAAAGTGG + Intronic
1074023755 10:109612566-109612588 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
1074088806 10:110227583-110227605 GGGGGTCAGGGGAAGGGACGAGG + Intronic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1074744194 10:116515084-116515106 GAGTGTGAGGGCCAGGGGAGGGG + Intergenic
1074766488 10:116703788-116703810 GGGTGTGCGGGGAAGGGAAGGGG + Intronic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1074826291 10:117217459-117217481 GTCTGTCCCGGGATGGGGAGGGG + Intergenic
1075714054 10:124545638-124545660 GTGTGTCAGGGGGCGGGGTGGGG + Intronic
1075973630 10:126675843-126675865 TTGTCTCAGGGGCAAGGGAGAGG - Intergenic
1076084077 10:127609984-127610006 GACTGTCATGGGAAGAGGAGTGG - Intergenic
1076288730 10:129327139-129327161 GTGTGTAAGGTGGAAGGGAGGGG + Intergenic
1076450024 10:130551023-130551045 ATGTGTCAGGGGAGGGGCTGAGG - Intergenic
1076676505 10:132149862-132149884 GTGGGGGAGGGGGAGGGGAGGGG - Intronic
1076879810 10:133234685-133234707 GGGTGTCAGGGAAGGGGGCGTGG + Intergenic
1076891055 10:133283628-133283650 GAGAGGCAGGGCAAGGGGAGAGG - Intronic
1077374123 11:2197616-2197638 GTGGGGCAGGGGAAGGGTGGCGG + Intergenic
1077640971 11:3881247-3881269 GGCTGCCAGGGGAAAGGGAGAGG - Intronic
1077695386 11:4388534-4388556 TAGTGTCAAGGGAAAGGGAGAGG + Intronic
1077840769 11:5972444-5972466 GAGTTTCAGGGGTAAGGGAGGGG - Intergenic
1078100537 11:8327936-8327958 GTGGGGAAAGGGAAGGGGAGTGG + Intergenic
1078161746 11:8846204-8846226 CTATGTCTGGGGAAAGGGAGAGG + Intronic
1078339419 11:10488389-10488411 GTGTGGTAGGGGAATGGAAGTGG + Intronic
1078749786 11:14150316-14150338 GGGAGTCAGGGGATGGTGAGAGG + Intronic
1079245022 11:18745537-18745559 GTGTGTGGGAGGCAGGGGAGGGG - Intronic
1079492937 11:21009931-21009953 GTGGGTGGGGGGAGGGGGAGGGG - Intronic
1079581030 11:22065236-22065258 TTGAGTCAGTGGAATGGGAGAGG + Intergenic
1079770541 11:24453093-24453115 GTGGGGTGGGGGAAGGGGAGAGG + Intergenic
1080424126 11:32140467-32140489 GTGGGCAAGGGGAAGGGCAGAGG - Intergenic
1080574092 11:33582685-33582707 GTGTCTCAGGGCAAGGGGGCTGG - Intronic
1080633672 11:34104940-34104962 GTGTATCTGGGGAAGGGGTTTGG + Intergenic
1080704442 11:34677174-34677196 TTGTTTCAGGGCAAGGGGATTGG + Intergenic
1080943350 11:36944013-36944035 GTGTGTGAAAGGAAGGAGAGGGG + Intergenic
1081204588 11:40260403-40260425 GTGGGTTAGGGGGAGGGGGGAGG + Intronic
1081226445 11:40528973-40528995 CAGTGTCAGGGGAGAGGGAGAGG + Intronic
1081291025 11:41326083-41326105 TTGAGTCAGTGGAATGGGAGAGG + Intronic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1082067341 11:47911404-47911426 CTGTGGCAGAGGGAGGGGAGAGG - Intergenic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1082814854 11:57501089-57501111 GTGCTGCAGGGGGAGGGGAGGGG - Intronic
1082901684 11:58261163-58261185 GTGGGACAGGGGGAGGGGGGAGG - Intergenic
1082940895 11:58703999-58704021 AAGTCTCAGGGGAAGGGGAAGGG - Intronic
1083427026 11:62593530-62593552 TTGTGAAAGGGGATGGGGAGGGG - Exonic
1083660226 11:64248698-64248720 GAGGGGCACGGGAAGGGGAGGGG - Intergenic
1083701149 11:64478418-64478440 GGCTCTCAGGGGAAGGGAAGTGG + Intergenic
1083736611 11:64685245-64685267 GGGTGCCAGGGGGTGGGGAGGGG - Intronic
1083742839 11:64720289-64720311 GTGTGGAAGGGGCAGGGGCGAGG + Intronic
1083802985 11:65057537-65057559 GTGTGGGTGGGGAAGGGGGGTGG + Intronic
1083853721 11:65382006-65382028 GTGGGCCAGGGGAGGGAGAGGGG - Intronic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084534433 11:69748332-69748354 GTGTCTCAGGAGGTGGGGAGAGG - Intergenic
1084536551 11:69760804-69760826 GTGTGTCAGGGGGAGGGTGGTGG + Intergenic
1084601204 11:70146953-70146975 TTGAGTCAGTGGAGGGGGAGAGG - Intronic
1085020229 11:73202079-73202101 GAGAGCCAGGGGAAGGGGTGGGG - Intergenic
1085083679 11:73652799-73652821 ATGTGACTGGGGCAGGGGAGGGG + Intronic
1085179373 11:74520663-74520685 GTGTGTCAGGGAGAGGGGAGAGG + Intronic
1085267482 11:75245820-75245842 GTGAGAGAAGGGAAGGGGAGGGG + Intergenic
1085638417 11:78175875-78175897 GTGGGGTAGGGGGAGGGGAGAGG - Intronic
1086048767 11:82564625-82564647 GGGGATCAGGGGAAGTGGAGGGG - Intergenic
1086242397 11:84711409-84711431 GTGTGTGGGGGGTGGGGGAGGGG - Intronic
1086383174 11:86280402-86280424 GTATTTCAGGGAAAGGAGAGAGG - Intergenic
1086851493 11:91814845-91814867 TTGTGTCAGTGGACTGGGAGAGG + Intergenic
1087159170 11:94932450-94932472 GCCTGTCAGGGGATGGAGAGTGG + Intergenic
1087596801 11:100264380-100264402 GTCTGTCAGGGGATGAGGGGAGG - Intronic
1087717820 11:101629400-101629422 TTGAGTCAGGGGAGTGGGAGAGG - Intronic
1087823478 11:102737868-102737890 GTGTGGCAGGGAGAGGGGTGGGG - Intergenic
1088336241 11:108707269-108707291 GAGGTTCAGGGGGAGGGGAGGGG - Intronic
1088366727 11:109047662-109047684 GTGTTTCTGGGGCAGGTGAGGGG + Intergenic
1089118513 11:116114962-116114984 GTGTGTTGGGGGATGGGGAGGGG - Intergenic
1089300055 11:117493079-117493101 GTGTGCAAGGGGTAGGGGTGAGG + Intronic
1089430293 11:118418009-118418031 ATGAGTCAGGGGTAGGGGACTGG + Intronic
1089538173 11:119173435-119173457 ATGTGTCAGGGAAAGGGGCCTGG - Intronic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089743344 11:120600124-120600146 GTGTGTTTGGGGAAAGGGAAAGG + Intronic
1089753995 11:120673073-120673095 AAGTGTCAGGGGCAGAGGAGGGG - Intronic
1090022288 11:123138605-123138627 TGGTGGCAGGGGAGGGGGAGGGG - Intronic
1090397464 11:126428531-126428553 GTGTGTGCGGGGGAGGGGAGGGG + Intronic
1090647177 11:128775732-128775754 ATGAGTCAAGGCAAGGGGAGAGG + Intronic
1091010448 11:131996293-131996315 GTATGGCAGGTGCAGGGGAGGGG - Intronic
1091011399 11:132004138-132004160 GTGTGTCAGGGGAATGAGGGGGG + Intronic
1091028373 11:132161641-132161663 GGGCGCCAGGGGAAGAGGAGAGG - Intronic
1091231600 11:133991331-133991353 GGGTGTCAGGGGTTGGGCAGAGG - Intergenic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1091755925 12:3051493-3051515 CTCTGTCAAGGGAAGGGGAGAGG - Intergenic
1092004985 12:5061571-5061593 GTGTGTATGGGCATGGGGAGAGG + Intergenic
1092145224 12:6210173-6210195 GTGGTTCTGGGGAAGGGCAGAGG + Intronic
1092192222 12:6529361-6529383 ATGGGACAGGGCAAGGGGAGTGG + Intronic
1092214596 12:6672280-6672302 GTGTGTCCGGGGCGGGGGTGGGG + Intronic
1092549443 12:9482111-9482133 AAGGGTCAGGGGAAGAGGAGTGG - Intergenic
1092839689 12:12528124-12528146 GTGGGTCAGGGAAGGGGAAGCGG - Intronic
1093207975 12:16273394-16273416 GAGTGTGAGTGGAAGGAGAGGGG + Intronic
1094084647 12:26576456-26576478 GTGTGGGAGGGGAAGTGAAGAGG - Intronic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1094311412 12:29087426-29087448 GTGTGTCAGGGCTAGGGGAGGGG - Intergenic
1094382131 12:29854456-29854478 GTGGGGTAGGGGAAGGGGGGAGG + Intergenic
1094521821 12:31199030-31199052 AAGGGTCAGGGGAAGAGGAGTGG + Intergenic
1094721039 12:33063883-33063905 CTGTCTCAGGGGGAGGGAAGGGG - Intergenic
1095069488 12:37823515-37823537 GTGGGTTAGGGGGAGGGGGGAGG - Intergenic
1095085797 12:38056531-38056553 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095948342 12:47766646-47766668 GGGGGTCAGGGGGAGGGGAGGGG - Intronic
1096499709 12:52057281-52057303 GTGTATCAGGGAAAGGGGCTGGG - Intronic
1097193050 12:57229143-57229165 GTGGGTCAGAGGAAGAGGGGAGG + Intergenic
1097222997 12:57461451-57461473 GTGTGTATGGGGAGGAGGAGGGG - Intronic
1098006933 12:66007518-66007540 GTGGGACAGGGGAAGGAGGGAGG - Intergenic
1098564389 12:71916160-71916182 GTCTGTATGGGGCAGGGGAGGGG - Intronic
1099020299 12:77395367-77395389 GTTGGTGGGGGGAAGGGGAGAGG + Intergenic
1099193366 12:79583931-79583953 GTCTGCCTGGTGAAGGGGAGAGG - Intronic
1099360127 12:81690493-81690515 GTGTGTTGGGGGAGGAGGAGTGG - Intronic
1099566622 12:84256780-84256802 GTGTGTGAGGGTAGGGGGAGTGG + Intergenic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1100204230 12:92330859-92330881 TTGAGTCAGTGGAAGGGTAGAGG + Intergenic
1100820742 12:98427260-98427282 GCCTGTCGGGGGAGGGGGAGGGG - Intergenic
1101096448 12:101346618-101346640 GTGTGTCATGGTATGGGAAGAGG - Intronic
1101126060 12:101634437-101634459 GAATGTCAGGTGAAGGGGGGAGG - Intronic
1101436537 12:104669211-104669233 GCGGGGCAGGAGAAGGGGAGGGG - Intronic
1101584439 12:106072685-106072707 ATGTGTATGGGGCAGGGGAGGGG - Intronic
1101673626 12:106898491-106898513 GTGGGGTGGGGGAAGGGGAGTGG + Intergenic
1101725114 12:107382327-107382349 GTCTGTCAAGGGAAGGGGTTTGG + Intronic
1102566985 12:113803324-113803346 CTGGGTCTGGGGAAGGAGAGTGG - Intergenic
1102731941 12:115119185-115119207 GTGAGGGAGTGGAAGGGGAGAGG + Intergenic
1103145754 12:118594514-118594536 GGGTGTCAGGGGTACAGGAGGGG + Intergenic
1103265295 12:119624664-119624686 GGTTGTCAGGGGCTGGGGAGAGG + Intronic
1103567782 12:121825489-121825511 GGGTGCAAGTGGAAGGGGAGAGG + Intronic
1103731511 12:123030970-123030992 GATTGTCAGGGGGTGGGGAGGGG + Intronic
1103747139 12:123132680-123132702 GTTTATCAGGGGTTGGGGAGGGG - Intronic
1103763773 12:123268312-123268334 GTGGGTGAGGGGAGGGGCAGAGG + Intronic
1103846745 12:123907288-123907310 GTGTGTCAGGGGTAGAGTACTGG + Intronic
1103975631 12:124700936-124700958 GAGTGTGGGGTGAAGGGGAGCGG + Intergenic
1104009603 12:124920574-124920596 GAGGGAAAGGGGAAGGGGAGGGG - Intergenic
1104053294 12:125210625-125210647 GGGTGGCAGGGGAGGTGGAGGGG + Intronic
1104212083 12:126698788-126698810 GGGGGTCACGGGGAGGGGAGAGG + Intergenic
1104623232 12:130333740-130333762 GGGTCTCAGGGCCAGGGGAGAGG + Intergenic
1104686379 12:130787627-130787649 GTGGCTCAGGCGGAGGGGAGAGG - Intergenic
1104718782 12:131033250-131033272 GTGTGGCAGGGGCTGGGGTGGGG + Intronic
1104969916 12:132526600-132526622 GTCTGTCTTGGGAAGGGGAGGGG + Intronic
1105007309 12:132729463-132729485 GGGTGGGAGGGGAGGGGGAGGGG + Intronic
1105007364 12:132729584-132729606 GGGTGGGAGGGGAAGGGGAGGGG + Intronic
1105623015 13:22087423-22087445 GGCTGTCAGCGGAAGAGGAGAGG - Intergenic
1105722896 13:23134615-23134637 GTGGGCCTGGGGAAGGGGTGGGG - Intergenic
1106079111 13:26485891-26485913 GGATGTCACGGGAGGGGGAGAGG + Intergenic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1106632026 13:31484493-31484515 GTGTGTCAGTGGCATGGGATAGG + Intergenic
1106813630 13:33383902-33383924 GAGTGTCGGGGGAGGGGAAGTGG + Intergenic
1106998515 13:35517191-35517213 GAGTGGCCAGGGAAGGGGAGCGG - Intronic
1107108688 13:36673744-36673766 GTGTGTCGGGGGGAGGAGGGGGG - Intergenic
1107417170 13:40211520-40211542 GGGGGTCAGGGGAATGGGAAAGG - Intergenic
1107554080 13:41502316-41502338 GTGGGACCAGGGAAGGGGAGGGG - Intergenic
1107556143 13:41518089-41518111 GTGTGTAGGGGGCAGGAGAGAGG + Intergenic
1107629985 13:42333607-42333629 CTGTGTCAGGAGACGGGGCGGGG - Intergenic
1107933028 13:45322029-45322051 TTGAGTCAGTGGAAAGGGAGAGG + Intergenic
1108631050 13:52282506-52282528 GTGGGGTAGGGGAAGGGGGGAGG + Intergenic
1108682368 13:52790910-52790932 GGGAGGCAGGGGGAGGGGAGGGG - Intergenic
1108728794 13:53210429-53210451 GTGTGCTAGGTGAGGGGGAGAGG + Intergenic
1108972537 13:56394961-56394983 TTGTGCCTGGGGGAGGGGAGTGG + Intergenic
1109061598 13:57629137-57629159 GTGTGTCGGGGGTTGGGGGGTGG + Intergenic
1109469781 13:62790258-62790280 GTGTGTCGGGGGGAGAGGTGGGG - Intergenic
1109489562 13:63078182-63078204 GGCTGCCAGGGGCAGGGGAGAGG - Intergenic
1109589000 13:64451452-64451474 GTGTGTTTGGGGCAGGGGGGTGG - Intergenic
1110010844 13:70331657-70331679 TTGTGGCAGGGGTTGGGGAGTGG + Intergenic
1110173197 13:72526709-72526731 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1110310041 13:74038221-74038243 CTGTGTCTGAGGAATGGGAGGGG + Intronic
1110469438 13:75842252-75842274 GTGAGTAAGGGGAAGAGTAGAGG - Intronic
1110893989 13:80726337-80726359 ACCTGTCAGGGGAAGGGGAGGGG - Intergenic
1111214985 13:85129879-85129901 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1111397229 13:87678645-87678667 GTGGGGCAGGGGCGGGGGAGGGG - Exonic
1111765559 13:92522617-92522639 GTGGGGTGGGGGAAGGGGAGAGG + Intronic
1111918973 13:94390784-94390806 GTGTGTCTGAAGAAGGGAAGTGG - Intronic
1111943375 13:94637706-94637728 GTGAGGTAGGGGGAGGGGAGAGG - Intergenic
1112039864 13:95535992-95536014 GTGTTTCAGTGGAAAGGGAAAGG + Intronic
1112532209 13:100216070-100216092 GAGGGGAAGGGGAAGGGGAGGGG - Intronic
1112665765 13:101571302-101571324 GTGAGTGGGGGGAAGTGGAGAGG - Intronic
1112715067 13:102174772-102174794 GAGGGTGAGGGGAGGGGGAGTGG + Intronic
1112787256 13:102964862-102964884 ATGTGTGAGGGAGAGGGGAGGGG - Intergenic
1112899170 13:104338329-104338351 GGGAGTCAGTGGAAAGGGAGGGG + Intergenic
1113061795 13:106330314-106330336 GGGGCTCAGAGGAAGGGGAGAGG - Intergenic
1113062062 13:106332642-106332664 GTGTGTTGGGGGCAGGGGGGCGG - Intergenic
1113088847 13:106596423-106596445 GTGTGTCGGAGGAGAGGGAGTGG - Intergenic
1113656220 13:112068995-112069017 GGGTCTCCGGGGAAGGTGAGTGG - Exonic
1113657069 13:112073567-112073589 GTGAGAGAGGGGAGGGGGAGGGG + Intergenic
1113769775 13:112900623-112900645 GTGTGTTGGGGGAAGAGGGGCGG + Intronic
1113904112 13:113811410-113811432 GGGTCTCCGGGGGAGGGGAGGGG + Intronic
1114346990 14:21806876-21806898 GCCTGTCGGGGGAGGGGGAGTGG + Intergenic
1114412888 14:22517418-22517440 AAGTGTCAGAGGCAGGGGAGAGG + Intergenic
1114840106 14:26253163-26253185 GTGTGTTTGAGAAAGGGGAGGGG - Intergenic
1115327583 14:32158995-32159017 CTTTGTCAGGGGGAGAGGAGTGG + Exonic
1115401639 14:32968087-32968109 GAGGGGCAGGGGATGGGGAGAGG + Intronic
1115649701 14:35394274-35394296 GGCTGCCAGGGGAAGTGGAGAGG - Intergenic
1116153100 14:41167170-41167192 GGAGGTCAGGGGAAAGGGAGGGG - Intergenic
1116242263 14:42359825-42359847 GTGGGGTAGGGGAAGGGGGGAGG + Intergenic
1116628433 14:47297463-47297485 GGGAGTGAAGGGAAGGGGAGTGG + Intronic
1116637295 14:47413398-47413420 GTTTTTAAGGGGAAGGGCAGTGG + Intronic
1116687487 14:48058875-48058897 GTGTGTTTGGGGGAGGGGTGAGG - Intergenic
1116908469 14:50431394-50431416 GTGGGGTGGGGGAAGGGGAGAGG - Intronic
1117048079 14:51833102-51833124 ATTTGTCAGGGGCAGGGGATGGG + Intronic
1117252654 14:53952224-53952246 GTGTCTCTGGGGAGGGGGAGGGG + Exonic
1117946890 14:61036443-61036465 GTGGGTGGGGGCAAGGGGAGGGG + Intronic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118607496 14:67514747-67514769 GGGTGTCAGGGGGAAGCGAGGGG - Intronic
1118967445 14:70600877-70600899 GTGGGGTAGGGGAATGGGAGGGG + Intergenic
1119199094 14:72739997-72740019 GAGTGTCAGGGTGATGGGAGGGG + Intronic
1119376595 14:74199099-74199121 GAGTGCCAGGAGCAGGGGAGAGG - Exonic
1119471848 14:74905472-74905494 GGGCCTCAGGGGAAGGGGTGGGG - Exonic
1119552138 14:75522721-75522743 GTTTGCCAGGGGGAGGAGAGCGG - Exonic
1119716894 14:76866128-76866150 GTGTGTCAGAGAGAGGGGAGAGG + Intronic
1120729497 14:87986669-87986691 GTGTGTCTGGGGTGGGGGTGGGG - Intronic
1121311097 14:92935536-92935558 GTGTGGCTGGGGACGGGGAGAGG - Intergenic
1121568764 14:94930624-94930646 GTGCTACACGGGAAGGGGAGGGG + Intergenic
1121711592 14:96042801-96042823 GTGTTTCCAGGGTAGGGGAGAGG - Intronic
1121777162 14:96598393-96598415 GAGGGGCAGGAGAAGGGGAGAGG - Intergenic
1121781562 14:96625373-96625395 GTGTGTGAGGGGAGGATGAGGGG - Intergenic
1121867340 14:97374835-97374857 GTCTGTCTGGGAAAGGGGAAAGG - Intergenic
1122075097 14:99230771-99230793 GTGTGTGAGGGGTGGGGGCGGGG - Intronic
1122100989 14:99409368-99409390 GTGTGCCCAGGGGAGGGGAGCGG + Intronic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122266299 14:100548497-100548519 GTGTGGCTGGAGAAGGGGTGAGG - Intronic
1122370823 14:101228054-101228076 TGGTGTGAGGGGAAAGGGAGGGG + Intergenic
1122463726 14:101916689-101916711 GGGTGTGAGGGGCAGGGGTGAGG + Intronic
1122740586 14:103869591-103869613 GTGTGGCAGGGGTGGGGGATGGG + Intergenic
1122782239 14:104148652-104148674 GCGTGGCCGGGGAGGGGGAGGGG + Intronic
1123000734 14:105292842-105292864 GTGGGCCTGGGGAAGGGGTGTGG - Intronic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1123174919 14:106407721-106407743 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1123490226 15:20774878-20774900 GAGTGGGGGGGGAAGGGGAGTGG - Intergenic
1123546727 15:21343965-21343987 GAGTGGGGGGGGAAGGGGAGTGG - Intergenic
1123703223 15:22931309-22931331 GTGAGTGAGGAGAATGGGAGTGG + Intronic
1123996481 15:25721327-25721349 GTGTGGCAGAGCAAGGGGACCGG + Intronic
1124629345 15:31327912-31327934 GAGCGGCAGGGGAAGGGGCGAGG - Intronic
1124811535 15:32944100-32944122 GAGTGCCTGGGGAAGGGGAAGGG + Intronic
1124899075 15:33805901-33805923 GGGTGAAAGGGGAGGGGGAGAGG - Intronic
1125501028 15:40240386-40240408 GTGTGTCAGGAGGAGGGGGGAGG + Intronic
1125534255 15:40434372-40434394 GTGTGCCTGTGAAAGGGGAGAGG + Intronic
1125555342 15:40580116-40580138 GTGTGACAGGAGAAGGAGGGAGG + Intergenic
1125610148 15:40964164-40964186 GGGTGGCAGGAGAAGGGAAGGGG + Intergenic
1126393465 15:48185134-48185156 GTTTGTGAGGGGAAGAGGAAGGG + Intergenic
1126779315 15:52125120-52125142 ATGTGTCTGGGGAAATGGAGTGG + Intronic
1127237145 15:57066722-57066744 GTTTGGCATGGGAATGGGAGAGG - Intronic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127354734 15:58187460-58187482 GTGTGTCAGGGCTGGGGGTGGGG + Intronic
1127507638 15:59611032-59611054 GAGGGTGAGGGGAGGGGGAGGGG - Intronic
1127862602 15:63006862-63006884 AGGAGTCAGGGGGAGGGGAGGGG + Intergenic
1127935255 15:63631213-63631235 GTTTGGCAAGGTAAGGGGAGAGG - Intronic
1128064433 15:64755584-64755606 GTTTGTGAGGGCAGGGGGAGCGG + Intronic
1128349854 15:66881510-66881532 GTGGGGCAGGGGAAGGCGGGTGG + Intergenic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1128385664 15:67146550-67146572 GTGTGTTCGGGGATGGGGAGCGG + Intronic
1128549668 15:68590178-68590200 GTGGGTGGAGGGAAGGGGAGAGG + Intronic
1128698231 15:69784940-69784962 GTGATTCAGGGGAATGGCAGGGG + Intergenic
1128748467 15:70131693-70131715 GTGTCTCAGGGCCAGGAGAGGGG + Intergenic
1128927383 15:71670639-71670661 GTGTGGCAGGGGGATGGGGGAGG - Intronic
1128983283 15:72201407-72201429 GTGTCTCAGGAGCTGGGGAGGGG + Intronic
1129170888 15:73807202-73807224 GTGAGGGAGGGGAAGGGGAGAGG + Intergenic
1129302152 15:74631635-74631657 CCGTTTCAGGGGAAGGGCAGAGG + Exonic
1129375878 15:75131115-75131137 GGTTGTCAGGGGCTGGGGAGAGG - Intergenic
1129385938 15:75196125-75196147 GGGTGTGAGGAGAAGAGGAGGGG - Intronic
1129394230 15:75235544-75235566 CTGTGTCAGAGGCTGGGGAGGGG - Intergenic
1129689456 15:77705158-77705180 GTGTGTCATGGCAGGGGGAGGGG - Intronic
1129883699 15:79023885-79023907 GTGTGTGAAGGGCAGGGTAGAGG - Intronic
1130307100 15:82720507-82720529 GAGGGGCAGGGGGAGGGGAGGGG - Intergenic
1130703930 15:86213916-86213938 GGGGTTGAGGGGAAGGGGAGTGG - Intronic
1130984077 15:88833404-88833426 GTGAGGCAGAGGAAGGGGACGGG - Intronic
1131202430 15:90410685-90410707 GTGGGGTAGGGGGAGGGGAGAGG + Intronic
1131223920 15:90608144-90608166 GTGAGTAAGGGGATGGAGAGAGG + Intronic
1131229212 15:90647605-90647627 GTGTGAAGGGGGAGGGGGAGGGG - Intergenic
1131270979 15:90947529-90947551 GTGTGGCCTGGGAAGGGGTGGGG + Intronic
1131359713 15:91780079-91780101 GGGTGTCAAGGTCAGGGGAGAGG - Intergenic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1132221627 15:100109476-100109498 GGGTGTGAAGGGAGGGGGAGGGG + Intronic
1132519444 16:380783-380805 TTATTTCAGGGGCAGGGGAGGGG + Intronic
1132556006 16:572976-572998 CTGTGTCTGAGGAAGGCGAGCGG + Intronic
1132804979 16:1771229-1771251 CGGTGTGGGGGGAAGGGGAGCGG - Intronic
1132907215 16:2288892-2288914 TTGTGGCAGGGGGAGGGCAGGGG - Intronic
1133036474 16:3036648-3036670 GTGCGGAAGGGGAGGGGGAGCGG - Intronic
1133216723 16:4297111-4297133 ATGTGTCATGGGAGGGGGACAGG + Intergenic
1133709215 16:8385103-8385125 TTGGGTCAGGGGCAGTGGAGGGG - Intergenic
1133813201 16:9177267-9177289 ATGGGAAAGGGGAAGGGGAGAGG - Intergenic
1134069127 16:11249881-11249903 GGGTGTCGGGGGAAGGAGATGGG + Intronic
1134167359 16:11941359-11941381 GAGGGGGAGGGGAAGGGGAGAGG + Intronic
1134493333 16:14712322-14712344 GAGGGGGAGGGGAAGGGGAGGGG - Intronic
1134498714 16:14751446-14751468 GAGGGGGAGGGGAAGGGGAGGGG - Intronic
1134525268 16:14938076-14938098 GAGGGGGAGGGGAAGGGGAGGGG - Intronic
1134547618 16:15122821-15122843 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1134581862 16:15377645-15377667 GAGGGGAAGGGGAAGGGGAGGGG + Intronic
1134712856 16:16336560-16336582 GAGGGGGAGGGGAAGGGGAGGGG - Intergenic
1134777383 16:16864981-16865003 GGGTGGCAGGGGAAGGGGTAGGG - Intergenic
1134953971 16:18372133-18372155 GAGGGGGAGGGGAAGGGGAGGGG + Intergenic
1135312792 16:21419007-21419029 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1135365715 16:21851287-21851309 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1135446099 16:22519875-22519897 GAGGGGGAGGGGAAGGGGAGGGG - Intronic
1135774170 16:25241805-25241827 CTGTGGCATGGGATGGGGAGAGG + Intronic
1135849173 16:25947071-25947093 GTGTGTGTGGTGATGGGGAGTGG + Intronic
1136040259 16:27572969-27572991 GTGAGTGAGGGGTAGGGGAGGGG - Intronic
1136151923 16:28356707-28356729 GAGGGGCAGGGGAGGGGGAGGGG + Intronic
1136151929 16:28356718-28356740 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1136151939 16:28356735-28356757 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1136151952 16:28356758-28356780 GAGGGGAAGGGGAAGGGGAGGGG + Intronic
1136168166 16:28470556-28470578 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1136168176 16:28470573-28470595 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1136168189 16:28470596-28470618 GAGGGGAAGGGGAAGGGGAGGGG + Intronic
1136168208 16:28470629-28470651 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1136211126 16:28758524-28758546 GAGGGGAAGGGGAAGGGGAGGGG - Intronic
1136211139 16:28758547-28758569 GAGGGGGAGGGGAAGGGGAGGGG - Intronic
1136211149 16:28758564-28758586 GAGGGGGAGGGGAAGGGGAGGGG - Intronic
1136211155 16:28758575-28758597 GAGGGGCAGGGGAGGGGGAGGGG - Intronic
1136255844 16:29038471-29038493 GAGGGGGAGGGGAAGGGGAGGGG - Intergenic
1136255860 16:29038499-29038521 GAGGGGGAGGGGAAGGGGAGGGG - Intergenic
1136255870 16:29038516-29038538 GAGGGGGAGGGGAAGGGGAGGGG - Intergenic
1136255876 16:29038527-29038549 GAGGGGCAGGGGAGGGGGAGGGG - Intergenic
1136322905 16:29499515-29499537 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1136412818 16:30086690-30086712 GTGTGTCTGGGGAGAGGGAAGGG + Exonic
1136437589 16:30239483-30239505 GAGGGGGAGGGGAAGGGGAGGGG + Intronic
1136468348 16:30460676-30460698 GAGAGGAAGGGGAAGGGGAGGGG + Intergenic
1137357069 16:47777206-47777228 GTTAGTTAGGGGAAGGGCAGGGG + Intergenic
1138027574 16:53534435-53534457 GTGAGTGAGTGGAGGGGGAGGGG + Intergenic
1138602803 16:58066815-58066837 GTCAGTGATGGGAAGGGGAGGGG - Intergenic
1138667713 16:58586292-58586314 GTGGGGGAGGGGGAGGGGAGGGG + Intronic
1138667728 16:58586325-58586347 GAGGGAGAGGGGAAGGGGAGGGG + Intronic
1138736818 16:59260407-59260429 GTGTGTCAGTGGACTGGGTGGGG + Intergenic
1138777526 16:59741868-59741890 GGGTGGTAGGGGAAGGGTAGGGG + Intronic
1139267717 16:65655953-65655975 GGGGGACAAGGGAAGGGGAGGGG - Intergenic
1139365469 16:66429707-66429729 GGGTGAATGGGGAAGGGGAGGGG - Intronic
1139857146 16:69990136-69990158 GAGGGGGAGGGGAAGGGGAGGGG + Intergenic
1140011442 16:71135286-71135308 GAGTGTCAGGGGAGGTGAAGTGG + Intronic
1140093075 16:71852952-71852974 GTTTGGCAGTGGAAGTGGAGGGG - Exonic
1141483105 16:84319737-84319759 GTGTGACAGGGAAAGGGTAGGGG - Intronic
1141729916 16:85815200-85815222 GGGTGCCAGGGGCTGGGGAGGGG - Intergenic
1141916006 16:87097571-87097593 GTGTGTCAGGGGGGGCGGGGGGG + Intronic
1142205876 16:88782930-88782952 CTGTGTCTGGGGATGGGGCGTGG - Intronic
1142312958 16:89324533-89324555 TTGAGTCAGTGGACGGGGAGAGG + Intronic
1142510034 17:387232-387254 CTGGGTCGGGGGAAGGGGAGTGG - Intergenic
1142726187 17:1816142-1816164 GTTTGCCAGGGGATGTGGAGAGG - Intronic
1143013501 17:3879330-3879352 GTGTGTCATCGGAGGGTGAGAGG - Intronic
1143472646 17:7185543-7185565 GTGCGCCAGGGCAAGGGAAGAGG + Intergenic
1143483014 17:7238187-7238209 GTGTGTCTGGGGTGGGGGTGAGG - Intronic
1143485599 17:7251995-7252017 GTGTCAAAGGGGAAGAGGAGGGG - Exonic
1143872340 17:9965961-9965983 GGGTGTCGGGGGATGGGGAAAGG - Intronic
1144170981 17:12659758-12659780 GTGTGTCGGGGGGTGGGGTGGGG - Intergenic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1144863947 17:18323101-18323123 GTGACTCAGGGTATGGGGAGGGG + Exonic
1144967552 17:19087583-19087605 GTGTGGCAGGGGTGGGGGTGGGG + Intergenic
1144980367 17:19164482-19164504 GTGTGGCAGGGGTGGGGGTGGGG - Intergenic
1144987855 17:19213750-19213772 GTGTGGCAGGGGTGGGGGTGGGG + Intergenic
1145257835 17:21337326-21337348 GTGTGTGTGTGGAGGGGGAGAGG + Intergenic
1145318798 17:21750681-21750703 GTGTGTGTGTGGAGGGGGAGAGG - Intergenic
1145829115 17:27900808-27900830 GTGGGTTAGGGGGAGGGGGGAGG - Intergenic
1145903086 17:28500395-28500417 GTTTGGCAAGGGAAGGGGAAGGG + Intronic
1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG + Intergenic
1146093028 17:29901128-29901150 GTGGGTTGGGGGGAGGGGAGAGG + Intronic
1146508920 17:33429080-33429102 GTGTGTCAGGGTAAGGTGTCTGG + Intronic
1146581351 17:34040723-34040745 GTGAGGCTGGGGAAGGGGAGAGG - Intronic
1146946237 17:36875622-36875644 GAGTCAGAGGGGAAGGGGAGGGG + Intergenic
1147168471 17:38605339-38605361 GTGTGGAAGGGGGAGGGGTGAGG - Intronic
1147184759 17:38707052-38707074 GTGTGGGAGGGGCAGGGGAGTGG - Intronic
1147210592 17:38870548-38870570 GTGTGTTGGGGGAAGGTTAGGGG + Intronic
1147365217 17:39954574-39954596 GTGTGTCCGTGGAGGGGAAGTGG - Intergenic
1147671690 17:42180356-42180378 GTGAGGCAGGAGGAGGGGAGCGG - Intronic
1147966337 17:44196230-44196252 GTGTGGGTGGGGAAGGGGGGTGG - Intronic
1148686213 17:49502577-49502599 GTGTGTTTGGGGGAAGGGAGAGG + Intronic
1148789844 17:50167030-50167052 GTGTGTGAGGGGATGTGGGGGGG - Intronic
1148930201 17:51121113-51121135 GGGTCCCAGGGGAAAGGGAGGGG + Intergenic
1149577535 17:57724868-57724890 GAGTGTCAGGGGTAGAGGGGTGG + Intergenic
1149795991 17:59520486-59520508 GGCTGTCAAGGGATGGGGAGGGG - Intergenic
1149839451 17:59946196-59946218 GTGAGTGAGGAGAAGGGCAGAGG + Intronic
1149863350 17:60136693-60136715 GTGTGTCGGGGGGGGGGGGGGGG - Intergenic
1150337662 17:64342330-64342352 CGGTGGCAGGGGAAGAGGAGTGG - Intronic
1150964790 17:69955848-69955870 TTGAGTCAGTGGAATGGGAGAGG - Intergenic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151194700 17:72423276-72423298 GTGTGTGGCGGGTAGGGGAGAGG - Intergenic
1151227997 17:72660895-72660917 ATGTCTCCGGGGAGGGGGAGGGG + Intronic
1151433314 17:74079618-74079640 GTTTGGCAGGGCAATGGGAGGGG - Intergenic
1151784070 17:76266403-76266425 GTGTGTGTGTGGAGGGGGAGGGG - Intronic
1151810982 17:76441778-76441800 GTTTATCAGTGGAGGGGGAGGGG - Intronic
1151898603 17:76996982-76997004 GTGTGTCAGGGCAAGGAGATGGG - Intergenic
1152245885 17:79184330-79184352 GTGTGTCTGGGTACAGGGAGGGG - Intronic
1152276481 17:79360858-79360880 TTATGTTGGGGGAAGGGGAGTGG + Intronic
1152410474 17:80120356-80120378 AGGTGACATGGGAAGGGGAGGGG - Intergenic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152648933 17:81483045-81483067 GTGAGTTAGTGGAGGGGGAGTGG + Intergenic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1153694467 18:7626547-7626569 GTGTGGCTGGGAGAGGGGAGAGG - Intronic
1154272772 18:12934114-12934136 CTGTGGCAGGGGGAGAGGAGAGG - Intergenic
1155305312 18:24472656-24472678 GTGTGATAGGGGAAAGGGATGGG + Intronic
1156122586 18:33863270-33863292 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
1156450187 18:37262387-37262409 GTGTGTGTGGGGTGGGGGAGGGG + Intronic
1156519784 18:37712578-37712600 GTGTGTGTGAGGGAGGGGAGGGG - Intergenic
1157079386 18:44506361-44506383 GTGTGTCAGAAGAAGGGAAAAGG - Intergenic
1157111178 18:44821638-44821660 GTGTGTCAGGAACAGGGGATAGG - Intronic
1157127521 18:44971017-44971039 GTGGGGTGGGGGAAGGGGAGAGG - Intronic
1157299274 18:46467914-46467936 GTGTGGTTGGGGAGGGGGAGAGG - Intergenic
1157617284 18:48994757-48994779 TTGTGTCGGGGGCAGGGGTGGGG - Intergenic
1157736626 18:50055239-50055261 GTGAGTCCGGGGCAGGGGGGCGG - Intronic
1158307082 18:56117571-56117593 CTCTGCCAGGGGAAGAGGAGGGG - Intergenic
1158599339 18:58843757-58843779 GAGTGGCAGGGGCGGGGGAGTGG - Intergenic
1158806932 18:60985192-60985214 GTGTGTCAGGGTAAGTAGACTGG - Intergenic
1159978806 18:74751514-74751536 GTGTGGTGGGGGGAGGGGAGAGG - Intronic
1160051399 18:75437449-75437471 ATGGGGGAGGGGAAGGGGAGAGG + Intergenic
1160447694 18:78940208-78940230 GTGTGGGAGGGGAAGAGCAGTGG - Intergenic
1160488899 18:79320316-79320338 CTCTGCCAGGGGAAGGGGAGGGG + Intronic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1160726752 19:620885-620907 GGGCGCCAGGGGAGGGGGAGGGG + Intronic
1160726771 19:620926-620948 GGGCGCCAGGGGAGGGGGAGGGG + Intronic
1160895151 19:1399021-1399043 GTGGTTCTGTGGAAGGGGAGTGG + Exonic
1160896362 19:1403962-1403984 GGGTGCCAGGGGCTGGGGAGGGG + Intergenic
1160923569 19:1532098-1532120 GTGGGTAGGGGGAAGGGGAAGGG + Intronic
1161128580 19:2574389-2574411 GAGTGCCAGGGGCTGGGGAGGGG - Intronic
1161135014 19:2614452-2614474 GGGTGCCAGGGGCTGGGGAGGGG - Intronic
1161147044 19:2685165-2685187 GAGTGCCAGGGGCTGGGGAGGGG + Intronic
1161168559 19:2801759-2801781 GTGTCACATGGCAAGGGGAGGGG + Intronic
1161202618 19:3024455-3024477 GGGTGCCAGGGGTTGGGGAGGGG - Intronic
1161222587 19:3124565-3124587 GGGTGCCAGGGGCTGGGGAGGGG - Intergenic
1161245285 19:3248383-3248405 GGGTGCCAGGGGCTGGGGAGGGG - Intronic
1161271306 19:3390848-3390870 GGGTGCCAGGGGCTGGGGAGGGG + Intronic
1161412498 19:4124118-4124140 GAGAGGCAGGGGGAGGGGAGGGG + Exonic
1161471190 19:4457475-4457497 GAGGGTCAGGGGAGGGGGAGAGG - Intronic
1161486797 19:4540149-4540171 GCCAGGCAGGGGAAGGGGAGGGG + Exonic
1161515009 19:4691579-4691601 GTGTGGCACGGGAAGGGGGGCGG + Intronic
1161624703 19:5319637-5319659 GTGAGTGATGGGGAGGGGAGAGG - Intronic
1161650465 19:5481047-5481069 GAGTGCCAGGGGCTGGGGAGGGG - Intergenic
1161694835 19:5760573-5760595 GGGTGCCAGGGGCTGGGGAGGGG + Intronic
1161749500 19:6084524-6084546 GGGTGCCAGGGGCTGGGGAGGGG - Intronic
1161928344 19:7318172-7318194 GGGTGCCAGGGGCTGGGGAGTGG - Intergenic
1161928967 19:7323414-7323436 GGGTGCCAGGGGCTGGGGAGGGG - Intergenic
1161987832 19:7667100-7667122 GGGTGCCAGGGGCTGGGGAGAGG + Intergenic
1161991995 19:7689446-7689468 TTGGGTCAGGGGATGGGGCGGGG + Intronic
1162083546 19:8234511-8234533 GGGTGCCAGGGGAAGGGAAATGG - Intronic
1162391214 19:10391283-10391305 GGGGGTCCGGGGAAGGGCAGAGG - Exonic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1162796289 19:13089274-13089296 GTGTGTCTGGTGCAGGGCAGCGG + Intronic
1162809242 19:13154334-13154356 GTATGTCAGCGGAGGGGGAAGGG - Exonic
1162969906 19:14174325-14174347 GGGTGTCAGGGGACAGGAAGCGG + Intronic
1163293556 19:16396944-16396966 GTGGGTGGGGGGATGGGGAGTGG + Intronic
1163682297 19:18690082-18690104 GGGGGTGAGGGGAAGGGAAGGGG + Intronic
1164068296 19:21741233-21741255 GTTTGTCAAGGGCTGGGGAGAGG + Intronic
1164394295 19:27850366-27850388 GTGTGTGTGGGGAAGGGGTGTGG + Intergenic
1164670764 19:30070770-30070792 GAGTGGCAGGGGCAGGGGTGTGG - Intergenic
1164800435 19:31071655-31071677 GTGTGTCGGGGGGTGGGTAGCGG + Intergenic
1165365086 19:35360270-35360292 GAGTGGCAGGGGCAGGAGAGGGG + Exonic
1165366904 19:35372738-35372760 GAGTGGCAGGGGCAGGAGAGGGG + Intronic
1165534064 19:36428637-36428659 CTGGGGCAGGGGATGGGGAGGGG + Intergenic
1165538750 19:36472743-36472765 GTGTGTTAGGTAAAGGGGAAAGG + Intronic
1165802636 19:38562371-38562393 GAGTGTGAGGGAATGGGGAGGGG - Intronic
1165823783 19:38693929-38693951 GTGAGTGCGGGGAAGGGGGGTGG - Intronic
1166206303 19:41271783-41271805 GTCTGGCAAGGGAGGGGGAGAGG - Intronic
1166305288 19:41934062-41934084 GGGTGCCAGGAGAAGGGCAGAGG + Intergenic
1166342942 19:42149777-42149799 TGGTGTGAGGGGCAGGGGAGAGG - Intronic
1166460669 19:42985274-42985296 GGGTGTCAAGAGATGGGGAGAGG - Intronic
1166730230 19:45055132-45055154 GTGTGGCAATGGTAGGGGAGAGG + Intronic
1167135186 19:47611395-47611417 GTGTGTGAGGAGTGGGGGAGGGG + Intronic
1167143005 19:47665078-47665100 GAGTGTGGGGGGTAGGGGAGAGG + Intronic
1167240822 19:48342158-48342180 GGGAGGGAGGGGAAGGGGAGGGG + Intronic
1167448994 19:49556218-49556240 GAGAGTTGGGGGAAGGGGAGGGG + Intronic
1167449021 19:49556282-49556304 GAGTGCTGGGGGAAGGGGAGGGG + Intronic
1167461278 19:49625878-49625900 GGGGGTCGGGGCAAGGGGAGAGG - Exonic
1167476241 19:49702893-49702915 GAGTGAGAGGGGAAGGGAAGAGG + Intronic
1167485923 19:49762981-49763003 GGGTGCTAGAGGAAGGGGAGGGG - Intronic
1167636649 19:50659547-50659569 GGGTGGGAGGGGAAGAGGAGGGG - Intronic
1167641953 19:50687079-50687101 GGACGTCAGGGGAAGGTGAGGGG + Intronic
1167687100 19:50963230-50963252 GTGTGCCAAAGGATGGGGAGTGG - Intronic
1167694633 19:51007537-51007559 GAGAGGCAGGGGAAGGGTAGGGG - Intronic
1167729678 19:51244631-51244653 GAGAGTAAGGGGAAGGGGACAGG - Intergenic
1168316914 19:55488544-55488566 GGGTGAAAGGGGAAGGAGAGCGG - Intronic
925094103 2:1181066-1181088 GTGGGGTGGGGGAAGGGGAGAGG + Intronic
925309489 2:2872342-2872364 TGCTGTCTGGGGAAGGGGAGGGG - Intergenic
925315399 2:2919132-2919154 CTGTGTCAGTAGATGGGGAGTGG + Intergenic
925454521 2:4003725-4003747 GTGTGTGTGTGGCAGGGGAGGGG - Intergenic
926146514 2:10399817-10399839 GAGTGTCTGGGGACGTGGAGAGG - Intronic
926392414 2:12406792-12406814 GTGAGTCAGTGGACTGGGAGAGG - Intergenic
926477723 2:13348387-13348409 TTGTGTCATGGGCTGGGGAGGGG + Intergenic
926497529 2:13609333-13609355 GTGGCTCTGGGGAATGGGAGGGG + Intergenic
926683610 2:15681183-15681205 GTGGGGGAGGGGGAGGGGAGGGG + Intergenic
926890403 2:17634592-17634614 GGGTGTCAGGGGACGGGAAGGGG - Intronic
926896418 2:17694198-17694220 GTGTGTCAGTGGGATGGGAGGGG + Intronic
926945014 2:18178097-18178119 GTGGGGCACGGGGAGGGGAGTGG - Intronic
926948523 2:18215933-18215955 GTGTGTGGTGGGGAGGGGAGAGG - Intronic
927071777 2:19538042-19538064 GGGTTTCAGGGGAGAGGGAGAGG + Intergenic
927088026 2:19690091-19690113 GAGGGGAAGGGGAAGGGGAGGGG + Intergenic
927111173 2:19864726-19864748 CTGTGTGAGAGGAAGGGCAGAGG - Intergenic
927275527 2:21259272-21259294 GTGTGTGTCGGGAAGGGGGGAGG + Intergenic
927681976 2:25145802-25145824 ATGTGTCAGGGGAGGGGAGGGGG - Intronic
927852183 2:26506400-26506422 GTGGGGAAGGGGCAGGGGAGAGG - Intronic
928404648 2:31005266-31005288 GTGTGTGTGGGGGTGGGGAGTGG + Intronic
928444863 2:31324692-31324714 GTGGGGCAGGGGAAGGGTCGGGG + Intergenic
928930512 2:36619305-36619327 GGATGGCAGGGGAAGAGGAGGGG - Intronic
929250527 2:39749755-39749777 GTCTGTCAGGGGGAGGTGGGAGG - Intronic
929404647 2:41627944-41627966 TTGAGTCAGTGGAATGGGAGAGG + Intergenic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
929766575 2:44848640-44848662 GTGTGTGTGGGGGAGGGGTGGGG + Intergenic
930288525 2:49465351-49465373 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
930288545 2:49465408-49465430 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
930364672 2:50424262-50424284 GGAGGACAGGGGAAGGGGAGGGG + Intronic
931068651 2:58618817-58618839 GTGTGTGGGGGGCAGGGGAGAGG + Intergenic
931625345 2:64252045-64252067 GTGTGGGTGGGGGAGGGGAGGGG + Intergenic
931734775 2:65183791-65183813 GTGGGGCGGGGGGAGGGGAGAGG + Intergenic
931881409 2:66574970-66574992 GTGGGGAAGGGGAAGGGGTGGGG - Intergenic
931949631 2:67348570-67348592 GGGTCTCAGGGGATGGGGGGTGG - Intergenic
932144132 2:69304307-69304329 GTGTGACAGGAGAAAAGGAGAGG + Intergenic
932312321 2:70753583-70753605 GTGTGTCAGGGGTTGGGGGGTGG + Intronic
932606796 2:73170654-73170676 GTGTGACAGAGGAAGGGAGGGGG + Intergenic
933726793 2:85431517-85431539 GTCTCTGAGGGGGAGGGGAGGGG + Intronic
933771333 2:85746287-85746309 GGATGTCAGGGGGAGGGAAGAGG + Intergenic
933925632 2:87089756-87089778 GTGTGACAGAGGAAGGGAGGGGG - Intergenic
933936234 2:87205874-87205896 GAGTCTCAGGGGATGGGGAAGGG - Intergenic
933940651 2:87242105-87242127 GGGAGGGAGGGGAAGGGGAGGGG - Intergenic
934031779 2:88055304-88055326 GAGCGTCAGGGAAAGGGAAGTGG - Intronic
934067069 2:88350469-88350491 GTGGGTCTGGGGAGGAGGAGGGG + Intergenic
934661191 2:96144612-96144634 GTGTGTTGGGGGAGGGGGTGGGG - Intronic
935219726 2:101002197-101002219 GTGTGGCTAGGGAAGGGGAGAGG - Intronic
935550761 2:104450973-104450995 GTGTGTGTAGGGAAGTGGAGAGG - Intergenic
935579469 2:104744256-104744278 GTGTGTAAAGCGGAGGGGAGGGG - Intergenic
935619643 2:105117586-105117608 GTGGGTATGAGGAAGGGGAGGGG - Intergenic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
936356915 2:111759955-111759977 GAGTCTCAGGGGATGGGGAAGGG + Intergenic
936790914 2:116150448-116150470 GTGAGTCAGTGAAATGGGAGAGG - Intergenic
936931176 2:117790377-117790399 GTGCGTGAGTAGAAGGGGAGAGG - Intergenic
937024044 2:118682746-118682768 GTGGGTCGAGGAAAGGGGAGAGG - Intergenic
937089783 2:119198489-119198511 GTGTGAGACGGGAAGGGAAGTGG - Intergenic
937417923 2:121731745-121731767 GTGAGCCAGGTGAAGGGGACAGG - Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937926324 2:127170454-127170476 GTGAGCCAGGTGAAGGGGACAGG + Intergenic
939045610 2:137246099-137246121 GGGTGGGAGGTGAAGGGGAGTGG + Intronic
939983226 2:148805668-148805690 GTGGGGGAGGGGAGGGGGAGGGG - Intergenic
940098928 2:150010915-150010937 GTGGGGTAGGGGAGGGGGAGGGG + Intergenic
940612138 2:156005984-156006006 GTGGGTGAAGGGAAGGAGAGAGG - Intergenic
940951734 2:159682905-159682927 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941794103 2:169581357-169581379 TTGTGTCAGTGGAAAGTGAGCGG - Intergenic
941973207 2:171374651-171374673 GTGAGTGGGGAGAAGGGGAGGGG - Intronic
942062912 2:172244285-172244307 TTAAGTCAGGGGAAGGGAAGAGG + Intergenic
942231130 2:173861768-173861790 GAGGGTGTGGGGAAGGGGAGAGG - Intergenic
942420517 2:175802274-175802296 GGGTGTCTGTGGCAGGGGAGTGG - Intergenic
942425787 2:175859160-175859182 GGGACTCAGGGGAAGGGGTGAGG - Intergenic
942489266 2:176473749-176473771 GGGGGTCAGAGGAAGAGGAGGGG - Intergenic
944336455 2:198540885-198540907 TTGAGTCAGGGGACTGGGAGAGG + Intronic
944447572 2:199806754-199806776 GTGTGTGGGGTGCAGGGGAGAGG - Intronic
944476665 2:200113430-200113452 GTGGGTCAGGGGATGGGGAAGGG - Intergenic
945352234 2:208794857-208794879 GTTTGTCAGGGGCAAGGGATGGG + Intronic
946007366 2:216536918-216536940 GTGATTCAGGAGCAGGGGAGGGG + Intronic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
946252933 2:218424352-218424374 GTGAGTCAGGGGCAGGGGAGGGG + Intronic
946322272 2:218960949-218960971 GTGTGTCAGGGGCTGGGGCGGGG - Exonic
946327477 2:218992353-218992375 GGGTGTCAGGGGAAGGGTTTGGG - Intronic
946409596 2:219509510-219509532 GAGGGGCTGGGGAAGGGGAGCGG - Intergenic
946429255 2:219615916-219615938 ATGGGCCTGGGGAAGGGGAGAGG + Intronic
946438877 2:219678492-219678514 GTGTGTCATGGTATGGGGGGTGG + Intergenic
946447127 2:219749545-219749567 TTGTTGCAGGTGAAGGGGAGAGG - Intergenic
946847639 2:223873885-223873907 GTGTGTCAGGGATGGGAGAGTGG - Intronic
946903689 2:224396194-224396216 GGGAGTCAGGGGAAGAGGATGGG - Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947984301 2:234436034-234436056 GTGTGTCAGAGGGAGGGGTGGGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948294105 2:236848045-236848067 GGGTGTAGGAGGAAGGGGAGAGG + Intergenic
948386839 2:237585843-237585865 GTGCGTGAGGGGAGGGGGTGAGG - Intronic
948516982 2:238510189-238510211 GTGCCTCAGGGAATGGGGAGAGG + Intergenic
948887398 2:240891121-240891143 GTCTGTGAGAGGAAGGAGAGGGG - Intronic
948916185 2:241035991-241036013 GCGCGTCACGGGGAGGGGAGTGG + Intronic
948995433 2:241575997-241576019 GAGTTGCAGGGGAAGGGGAGAGG - Intergenic
949060350 2:241953237-241953259 GAGAGGGAGGGGAAGGGGAGGGG + Intergenic
1169152660 20:3302505-3302527 GTATTTTAGGGGATGGGGAGGGG - Intronic
1169503122 20:6180578-6180600 GGCTCTCAGGGAAAGGGGAGTGG - Intergenic
1169569918 20:6894979-6895001 CTGTGTCTGGGGGTGGGGAGGGG + Intergenic
1169757990 20:9063888-9063910 GGGTGGCTGGGGAAGGGCAGTGG + Intergenic
1170428612 20:16258589-16258611 GTGTGTTTGGGGATGGGAAGGGG - Intergenic
1170629357 20:18055085-18055107 GTGTGCTGGGGGAAGGGGGGCGG - Intronic
1171168861 20:22997692-22997714 GTGTGTGTGTGTAAGGGGAGGGG + Intergenic
1171412777 20:24957932-24957954 ATGAGTCAGGGAAAGGGCAGTGG - Intronic
1171769403 20:29310965-29310987 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1172024156 20:31936636-31936658 CTGTGTCAGGGGGTGGGAAGCGG - Intronic
1172150800 20:32789013-32789035 GTGAGTCCGGGGAAGGGCAAGGG + Intronic
1172186492 20:33034295-33034317 GTGTGGCAGGGGAGGGGCAGCGG + Intronic
1172303958 20:33868585-33868607 GTTAGTCGGGGGAAGTGGAGAGG - Intergenic
1172331839 20:34080818-34080840 TTGTGTCAGGGGCAGGAAAGGGG - Intronic
1172625256 20:36343008-36343030 CTGAGTGAGGGGGAGGGGAGAGG + Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1172837467 20:37882267-37882289 GTGAGTGAGGGGAAGACGAGGGG + Intergenic
1172840866 20:37902207-37902229 GTGTGGCAGGGGAGGGGGATAGG - Intergenic
1172908644 20:38388911-38388933 GTGTGCCAGGGGAAAGGTAGAGG + Intergenic
1173231978 20:41205549-41205571 GTGTGTGAACGGAAGGGGTGGGG + Intronic
1173285802 20:41670572-41670594 GTGTGTGAGGGGGGTGGGAGTGG + Intergenic
1173313076 20:41917684-41917706 GTGGGGAAGGGGGAGGGGAGGGG + Intergenic
1173485558 20:43438553-43438575 GTGTGTGGGGGGATGGGGATGGG - Intergenic
1173556512 20:43969924-43969946 GTGTGTTAGGGGCAGGCAAGGGG - Intronic
1173564964 20:44032076-44032098 CGGTGTGAGGGGCAGGGGAGCGG + Intronic
1173656731 20:44704695-44704717 GTGTGTTAGGGGGAGGGTGGGGG - Intergenic
1174038398 20:47682433-47682455 CTGCGTCTGGGGCAGGGGAGCGG - Intronic
1174280401 20:49434918-49434940 GTGTGGCAGTGGCCGGGGAGGGG + Intronic
1174490350 20:50888868-50888890 GGGTGTCGGGGGAAGGGGGTGGG - Intergenic
1174689854 20:52493120-52493142 GTGTGTTTGGGGACGGGTAGGGG + Intergenic
1174907860 20:54571620-54571642 GTATCTCTGGGGAAGGGGGGTGG + Intronic
1174924500 20:54742762-54742784 GTGTGTGTGGGGAGGGGGTGGGG + Intergenic
1175557961 20:59887143-59887165 GTGGGGTAGGGGAAGGGGGGAGG - Intronic
1175653337 20:60748095-60748117 GAGTGTCAGTGGAAGGAGACTGG - Intergenic
1175815811 20:61882729-61882751 GCGTCTCAGGAGAATGGGAGAGG + Intronic
1176017429 20:62942497-62942519 TTATGTCAGGGGCAGGGGAAGGG + Intronic
1176081551 20:63275950-63275972 GTGGGTCAGGGCAAGGCGTGAGG - Intronic
1176214544 20:63941923-63941945 GTGTGGCAGGGGAAGGAAAGAGG + Intronic
1176303180 21:5108583-5108605 ATGTGGCTGGGGAAGGGGTGTGG - Intergenic
1176551852 21:8226565-8226587 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176570761 21:8409564-8409586 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176578670 21:8453711-8453733 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176733277 21:10521187-10521209 GTGTGCCTGGGCGAGGGGAGGGG - Intergenic
1176913476 21:14596869-14596891 GTGGGTCAGGAGTTGGGGAGTGG - Intronic
1177249383 21:18572288-18572310 TGGTGGAAGGGGAAGGGGAGGGG + Intergenic
1177538961 21:22466539-22466561 GGGCGACAGTGGAAGGGGAGGGG + Intergenic
1178413743 21:32387173-32387195 AGGTGTCAGTGGTAGGGGAGGGG - Intronic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1178951984 21:36992806-36992828 TGGTGCCAGGGGAGGGGGAGTGG - Intergenic
1179106860 21:38408806-38408828 ATGTGTAGGAGGAAGGGGAGGGG + Intronic
1179299687 21:40095521-40095543 GGTTGTCAGGGGCAGGGTAGGGG + Intronic
1179381689 21:40905287-40905309 GTGTGTAAGGGGAAAAGAAGGGG + Intergenic
1179451721 21:41472807-41472829 GTGTTTAAGGAAAAGGGGAGGGG + Intronic
1179853845 21:44153341-44153363 ATGTGGCTGGGGAAGGGGTGTGG + Intergenic
1179881887 21:44296477-44296499 CTGAGGCAGGGGAGGGGGAGTGG - Intronic
1179931391 21:44573290-44573312 GTGTGCCAGGCTATGGGGAGTGG - Intronic
1180094449 21:45549621-45549643 ATGTGGCAGGGGAGGGGCAGGGG + Intergenic
1180129244 21:45816440-45816462 GAGGGGCAGGGGACGGGGAGGGG - Intronic
1180237164 21:46469764-46469786 GTTTGCCAGGGGAAGAGGAAAGG - Intronic
1180258557 21:46650813-46650835 GTGGGGCAGAGGGAGGGGAGAGG + Intronic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1180789315 22:18565961-18565983 GTGTGTCTGTGGAAGGGATGAGG - Intergenic
1180872529 22:19154635-19154657 GAGGGGGAGGGGAAGGGGAGGGG - Intergenic
1181232426 22:21429350-21429372 GTGTGTCTGTGGAAGGGATGAGG + Intronic
1181246225 22:21505507-21505529 GTGTGTCTGTGGAAGGGATGAGG - Intergenic
1181305737 22:21916372-21916394 GTCTGCCTGGGGAAGGGGTGGGG - Intergenic
1181316124 22:21971938-21971960 GTGTGGCAGGTGGAGGGCAGAGG - Exonic
1181469965 22:23132195-23132217 GGGAGTGAGGGGAAGGGCAGAGG + Intronic
1181669437 22:24419290-24419312 GTGAGGCAGGGGGAGGGGTGCGG + Intronic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1182032653 22:27171594-27171616 GTTTGACTGGGGAATGGGAGAGG - Intergenic
1182351159 22:29700782-29700804 GCCTGGCAGGGGAGGGGGAGAGG - Intergenic
1182409158 22:30167958-30167980 GTGTGTGATGGGAGGGGGAGTGG - Intronic
1182435243 22:30326136-30326158 GTCTGTCCTGGGAAGGGGTGGGG + Intronic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1182585909 22:31344297-31344319 GTGTGGCAGGGGAGGAAGAGGGG + Intronic
1182592122 22:31389497-31389519 GGGAGGCAAGGGAAGGGGAGGGG - Intergenic
1183037513 22:35151313-35151335 GTGAGGCAGGGGAGAGGGAGGGG - Intergenic
1183347801 22:37317557-37317579 CTGTGTCAGGGCACGGGGCGGGG + Intergenic
1183369878 22:37426568-37426590 AGCTGTCAGGGGACGGGGAGGGG - Intronic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183535736 22:38399258-38399280 GTGTGCCCGGGCGAGGGGAGGGG + Intergenic
1183770142 22:39917378-39917400 ATCTGGCAGGTGAAGGGGAGAGG - Intronic
1184400083 22:44268663-44268685 GTGTTTTAGAGGATGGGGAGAGG + Intronic
1184420777 22:44381765-44381787 GGGAGGAAGGGGAAGGGGAGGGG + Intergenic
1184468999 22:44684922-44684944 GGCTCTCAGGGGAAGGGAAGTGG + Intronic
1184482933 22:44758696-44758718 GTGTGCCAGGGCAAAGGCAGTGG + Intronic
1184641261 22:45871646-45871668 TTGTGTCTGGGGTTGGGGAGGGG + Intergenic
1184978641 22:48080868-48080890 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1184987994 22:48148345-48148367 GTGGGTCAGGGTGAGGGGAGTGG + Intergenic
1184996313 22:48209866-48209888 GGGTGGCAGGGGAAGGGTTGGGG + Intergenic
1185040243 22:48500267-48500289 GTTGGTCAGGGACAGGGGAGTGG - Intronic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185212166 22:49576452-49576474 GCCTGTCAGAGGACGGGGAGAGG - Intronic
1185427581 22:50781998-50782020 GTGTGTCAGGTGGAGGGGGCAGG - Intronic
1203256873 22_KI270733v1_random:143487-143509 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
949514264 3:4792985-4793007 GAGTATATGGGGAAGGGGAGTGG + Intronic
949791617 3:7798665-7798687 CTGTTTCAGGGGAACGTGAGAGG + Intergenic
949861522 3:8509667-8509689 GTGTGTGTTGGGGAGGGGAGAGG - Intronic
950469706 3:13177030-13177052 GGATGTCAGGGGCTGGGGAGAGG + Intergenic
950526461 3:13526920-13526942 GTGTGGCAGGCTAAGGTGAGAGG + Intergenic
950527152 3:13531107-13531129 GGGTGCCAGGGGCAGGGGAAGGG + Intergenic
950660348 3:14463425-14463447 TTGTGTCAGGGACAGGGGTGTGG - Intronic
950687504 3:14629013-14629035 GTATCTGAGGGGAAAGGGAGTGG + Intergenic
951017441 3:17745836-17745858 GGGTGGCAGGGGAGGGGGAGCGG - Intronic
951367585 3:21803085-21803107 GGGTGTCAGGTGGCGGGGAGGGG - Intronic
951465612 3:22997556-22997578 GTGGGGGAGGGAAAGGGGAGGGG + Intergenic
951570042 3:24052937-24052959 GTGGGGTAGGGGGAGGGGAGAGG - Intergenic
951962782 3:28348391-28348413 GGGTGACAGGGGAAAGGGTGTGG + Intronic
952749943 3:36816960-36816982 GTGGGAAAGGGGAAGGGGAAGGG - Intergenic
953341001 3:42134189-42134211 GGGGGGAAGGGGAAGGGGAGGGG - Intronic
953607021 3:44418929-44418951 GTGTGGTAGGGAAAGGGTAGGGG - Intergenic
953752994 3:45623707-45623729 GTGTGTGAGGGAGAGGGCAGAGG + Intronic
953759740 3:45677141-45677163 GTGGGGTAGGGGAAGAGGAGGGG + Exonic
954002903 3:47571731-47571753 GAGTCTCAGGTCAAGGGGAGGGG + Intronic
954139000 3:48595408-48595430 GTTTGTCTGGGGGAGGGGTGGGG - Intergenic
954361220 3:50123923-50123945 GTCTGTCAGGGAAACAGGAGAGG - Intergenic
954411812 3:50374233-50374255 GAGGGTGGGGGGAAGGGGAGGGG + Intronic
954938642 3:54350456-54350478 GAGTGTCAGTGCAAGTGGAGGGG + Intronic
955214602 3:56974657-56974679 GGGGGGCAGGGGGAGGGGAGAGG - Intronic
955303356 3:57805884-57805906 GTGAGTCAGGGGAAGTAGGGAGG - Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955687472 3:61561770-61561792 TTGCGAGAGGGGAAGGGGAGGGG - Intronic
956405353 3:68923079-68923101 GCCTGTATGGGGAAGGGGAGTGG - Intronic
956607690 3:71089454-71089476 GTGAGTCAGAGATAGGGGAGTGG - Intronic
956683419 3:71802815-71802837 GGGAGTCAGGGGAAGGGGAAAGG + Intergenic
957124914 3:76146722-76146744 GTGTGTCTGGTGGAGGGGAGAGG + Intronic
957124928 3:76146851-76146873 GTGTGTGTGGTGGAGGGGAGAGG - Intronic
957243812 3:77692901-77692923 GTGTGTGTTGGGAAGGGGAGTGG - Intergenic
957483455 3:80828284-80828306 GTGAGTCAGTGGACTGGGAGAGG + Intergenic
958060121 3:88468720-88468742 GGGTGTCAGTGGACTGGGAGAGG + Intergenic
958420686 3:93926929-93926951 TAGTGTTAGGGGGAGGGGAGAGG - Intronic
958661738 3:97077542-97077564 GCCTGTCAGGGGAGGGGGATGGG - Intronic
959095539 3:101951395-101951417 GTGGGGCAGGGGTAGGGGAGTGG + Intergenic
959425156 3:106178196-106178218 TTGTGTCAGTGGACTGGGAGAGG - Intergenic
959864763 3:111253404-111253426 GGGTGTCGGGGGTAGGGGAAGGG + Intronic
960292007 3:115897153-115897175 GTGTGGCAGGGGGAGGGAGGAGG + Intronic
960322049 3:116248702-116248724 GTGAGTCGGGGGAAGGAAAGGGG - Intronic
960505548 3:118489026-118489048 GTGTGTGAGGTGAGGGGGTGGGG + Intergenic
960701570 3:120444426-120444448 GTCTGTCATGGGTAAGGGAGAGG + Intronic
961137693 3:124527230-124527252 GAGTGTCGGGGGAAATGGAGAGG + Intronic
961576302 3:127839452-127839474 GGTTGCCAGGGGATGGGGAGAGG + Intergenic
961823784 3:129588351-129588373 GGGTGTCGGGGGTGGGGGAGGGG + Intronic
962025116 3:131539685-131539707 GTGTGTGTGGGGAAGTGGGGAGG + Intronic
962319511 3:134378643-134378665 GGGGGTGAGGGGAGGGGGAGGGG + Intergenic
962370897 3:134820043-134820065 GTGGGTGAGGGGAGGGGAAGGGG - Intronic
962610806 3:137074587-137074609 GTGTGTGAGGTGAGGTGGAGTGG + Intergenic
962627729 3:137243402-137243424 GTGTTTTAGGGGAGGGGGTGCGG - Intergenic
962738630 3:138347487-138347509 TTTTGTGAGGGGCAGGGGAGGGG + Intergenic
963259763 3:143180094-143180116 GCCTGTCAGGGGAGGGGGTGGGG - Intergenic
964146492 3:153470397-153470419 GAGGGAAAGGGGAAGGGGAGAGG - Intergenic
964234622 3:154510850-154510872 GGGTGTCAGGGCAGGGGGAGGGG + Intergenic
964881045 3:161423212-161423234 GTGAGCCAGGGGTTGGGGAGTGG - Intergenic
965384324 3:168027697-168027719 ATGTGTCAGGGGCAGAAGAGAGG + Intronic
965502207 3:169470564-169470586 GTGTATGAGGGGGAGGGGACAGG + Intronic
965809353 3:172576307-172576329 GCCTGTCAGGGGATGGGGAAGGG + Intergenic
966772001 3:183512244-183512266 TTGCGTGAGGGGAAGAGGAGAGG + Intronic
966878120 3:184335159-184335181 GTGTGTCTTGGGGTGGGGAGGGG + Exonic
966888606 3:184390226-184390248 GAGAGTGAAGGGAAGGGGAGGGG - Intronic
967772053 3:193344666-193344688 GAGTGACATGTGAAGGGGAGAGG + Intronic
967790937 3:193548332-193548354 GGGTGTAATGGGAAGGGGAAGGG + Intronic
968272652 3:197416453-197416475 CTGGGACAGGGTAAGGGGAGAGG - Intergenic
968584138 4:1408110-1408132 GCGGGGGAGGGGAAGGGGAGGGG - Intergenic
968741733 4:2334749-2334771 GTGGGGAGGGGGAAGGGGAGGGG - Intronic
968897808 4:3414927-3414949 GTGTGTGAGGGGCATGTGAGGGG + Intronic
969098231 4:4750370-4750392 GTGTGGCTTGGGAAGGGGCGTGG - Intergenic
969129699 4:4982427-4982449 GTGGGTCAGGAGACAGGGAGGGG - Intergenic
969302351 4:6304545-6304567 GTGGCCCAGGGGAAGGGGACAGG - Intergenic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969491883 4:7504096-7504118 GGGTGCCAGGGGTAGGGCAGGGG + Intronic
969680290 4:8639618-8639640 GTGGGTAAGGGGGAGGGGAGAGG + Intergenic
970487223 4:16536691-16536713 GTGGGTCAGGGGATGGAGAATGG + Intronic
970609872 4:17714975-17714997 GGAGGTGAGGGGAAGGGGAGGGG - Intronic
970991754 4:22220924-22220946 GAGAATCAGAGGAAGGGGAGAGG + Intergenic
971506359 4:27370267-27370289 GTGAGAAAAGGGAAGGGGAGGGG - Intergenic
972117180 4:35650915-35650937 GTGGGGCAGGGGAAGGGGGGAGG + Intergenic
972269180 4:37493495-37493517 GAGTGGCAGGGAAAGGGGAGAGG - Intronic
972503552 4:39698752-39698774 GTGGGTTGGGGGAAGGGGAAAGG + Intronic
972685213 4:41346008-41346030 GTATGTGGGGGGAAGGGCAGGGG - Intergenic
972715434 4:41641258-41641280 GTGTGTCTGGGGATGGGGGTTGG - Intronic
973362873 4:49181324-49181346 GTGTGTCAGGGGCAGACGACAGG - Intergenic
973398225 4:49615530-49615552 GTGTGTCAGGGGCAGAAGACAGG + Intergenic
973586283 4:52395127-52395149 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
973640233 4:52895313-52895335 GTGGGGTAGGGGTAGGGGAGAGG - Intronic
973981287 4:56310266-56310288 GTGTGGCTGGAGAAGGGGAGAGG + Intronic
973994242 4:56440486-56440508 GTTGGGCAGGGGAAGGGGTGGGG - Intronic
974135432 4:57810939-57810961 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
974413747 4:61577206-61577228 GTGTGTTAGGGAAATGGGGGGGG + Intronic
974801144 4:66819694-66819716 GGTTGTCAGGGGTTGGGGAGTGG + Intergenic
974969364 4:68805204-68805226 TTGTTTCAGGGGAGGGGGAAGGG - Intergenic
975472715 4:74788962-74788984 GTGTGTCGGGAGAGAGGGAGTGG + Intronic
975485943 4:74934044-74934066 GTGGTGCAGGGGGAGGGGAGAGG - Intronic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
975691041 4:76963945-76963967 GTGGGGTAGGGGGAGGGGAGAGG - Intronic
976595513 4:86892056-86892078 GTCCGTCCGGGGAAGGGTAGGGG - Intronic
976679989 4:87745799-87745821 GTGTGGGAGGGGAAGCTGAGGGG - Intergenic
976753860 4:88477545-88477567 GTGGGGGAGGGGAAGGGGAAGGG + Intronic
976822473 4:89222062-89222084 GTTTGCCAGGGGTAAGGGAGTGG - Intergenic
977150254 4:93502703-93502725 GTGTGTGTGGGGGGGGGGAGTGG - Intronic
977249483 4:94674118-94674140 GAGTGTCAGGGGAAAGTGTGGGG - Intergenic
977323618 4:95548869-95548891 GTGTGCCGGGGGGAGGGGAGGGG + Exonic
977762545 4:100756723-100756745 TTGTGTCAGTGGACTGGGAGAGG - Intronic
978058572 4:104306733-104306755 CAGTTTCAGGGAAAGGGGAGTGG + Intergenic
978378975 4:108106391-108106413 GTGTGCCGGGTGAAGGGGAAAGG + Intronic
978949602 4:114542088-114542110 ATTTGTCAGTGGAATGGGAGAGG + Intergenic
979441502 4:120755696-120755718 CAGTGTCAGGGACAGGGGAGAGG - Intronic
979508922 4:121529398-121529420 GTGTGTCAGGGGTAGTGGGTAGG - Intergenic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
980281992 4:130734715-130734737 GTGGGGCAGGGGGAGGGGGGAGG + Intergenic
980563629 4:134508849-134508871 GTGGGTTAGGGGAAGTGGAATGG - Intergenic
980653174 4:135747933-135747955 GTGGGGCAGGGGGAGGGGGGAGG - Intergenic
981032635 4:140140817-140140839 GTGGGACAGGAGATGGGGAGAGG + Intronic
981121488 4:141056454-141056476 GGGTGTGAGGGGCAGGGGTGTGG + Intronic
981622126 4:146713136-146713158 GTGTGTAAGAGGTGGGGGAGGGG + Intronic
981878782 4:149581919-149581941 GTATGTGAGGAGAAGGGGAGGGG + Intergenic
981929352 4:150173159-150173181 GGGAGTTAGGGGAAGGGCAGAGG + Intronic
981968814 4:150639202-150639224 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
982150410 4:152449027-152449049 GTGTGTGTGGAGACGGGGAGGGG - Intronic
982329852 4:154169538-154169560 GTGGGGGAGGGGAGGGGGAGGGG - Intergenic
982738583 4:159033726-159033748 GTGAGTCACAAGAAGGGGAGTGG + Intronic
982978853 4:162104463-162104485 GTGTTACAGGGGTCGGGGAGTGG - Intronic
983489600 4:168372750-168372772 GGGAGTCGAGGGAAGGGGAGGGG + Intronic
984070391 4:175103532-175103554 GAGTGGGAGGGGGAGGGGAGGGG + Intergenic
984867331 4:184292999-184293021 GTGTGTGGAGGGGAGGGGAGGGG + Intergenic
985040374 4:185885800-185885822 GAGTGTCATGGGAAGTGGAGTGG - Intronic
985678474 5:1244167-1244189 GGGGGTAAGGGGATGGGGAGTGG - Intronic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985942625 5:3150732-3150754 GTATGTGAGGGGGAGGGAAGGGG + Intergenic
986001723 5:3635653-3635675 GTAGGTCGGGGGGAGGGGAGGGG - Intergenic
986038818 5:3967090-3967112 GGGTGTGAGAGGAAGGGAAGTGG - Intergenic
986100969 5:4610948-4610970 GTTTTTCAGGGGAAGGGAAAAGG + Intergenic
986244353 5:5991930-5991952 GTGTGGCATGGCAGGGGGAGGGG + Intergenic
986328864 5:6702951-6702973 GAGTGAGAGGGGAAGGGGAGAGG - Intergenic
986831304 5:11581849-11581871 GTGGGGCATGGGAAGGGGAAGGG + Intronic
987550392 5:19372626-19372648 TTGTGTCAGTGGACTGGGAGAGG + Intergenic
988487995 5:31682845-31682867 GAAAGTCAGGGGAAAGGGAGGGG - Intronic
988509827 5:31855448-31855470 GTGTGTGACGGGCAGGGAAGGGG + Intronic
988517021 5:31913935-31913957 GTGTGCTGGGGGTAGGGGAGAGG - Intronic
988808300 5:34760901-34760923 GGTTGCCAGAGGAAGGGGAGGGG - Intronic
988850708 5:35177472-35177494 GTTTGCCAGGGGCTGGGGAGAGG - Intronic
989072750 5:37528478-37528500 GTGGGTTAGGGGGAGGGGTGAGG + Intronic
989191085 5:38670457-38670479 CTGTCTCTGGGGGAGGGGAGAGG - Intergenic
989356685 5:40551458-40551480 TTGTGTCAGTGGACTGGGAGAGG + Intergenic
989983260 5:50667357-50667379 GTGGGGGAGGGGAAGGGGAGAGG - Intronic
990109240 5:52303735-52303757 GTGTGTCAGGGAGTGGGGGGTGG + Intergenic
990760345 5:59122399-59122421 GTGTGTAGGTGGGAGGGGAGGGG + Intronic
990996482 5:61737058-61737080 GGGTGACTGGGGGAGGGGAGCGG + Intronic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
991693175 5:69245310-69245332 GTAAGGGAGGGGAAGGGGAGGGG - Intronic
992081075 5:73234486-73234508 GTGTGTGAAGGGGCGGGGAGGGG - Intergenic
992198110 5:74359575-74359597 GAGGGTGAGGGGAAGGGGAGAGG + Intergenic
992506875 5:77395733-77395755 GTGTGTCTGGTGAGGGGGTGGGG - Intronic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
992640327 5:78763435-78763457 GGGTGAGAGGGGAAGGGGAAGGG - Intronic
993399521 5:87431638-87431660 GAGTTTGAGGGGAAGGGGAATGG + Intergenic
993521831 5:88912202-88912224 GTTAGGGAGGGGAAGGGGAGAGG + Intergenic
993711095 5:91226135-91226157 GTGTGTTGGGGTAGGGGGAGGGG + Intergenic
993734199 5:91456790-91456812 GTTTTTCAGGGGATAGGGAGGGG - Intergenic
994050354 5:95355780-95355802 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
994120958 5:96112212-96112234 GTGTGTCTGGGGAAAGCCAGTGG + Intergenic
994946955 5:106406863-106406885 GTGTGTTAGGGGTTGGGGAGTGG + Intergenic
995109324 5:108411382-108411404 GCCTGTCAGGGGGTGGGGAGGGG - Intergenic
995183704 5:109251138-109251160 GTGTGGGAGGGGAAAGGGTGGGG - Intergenic
995546793 5:113240551-113240573 ACGTATCAGAGGAAGGGGAGTGG - Intronic
995584698 5:113636249-113636271 GTGAGTCAGCGGACTGGGAGAGG + Intergenic
995855738 5:116590212-116590234 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
996457670 5:123703405-123703427 GAGTGTGAGGAGAATGGGAGTGG + Intergenic
996515631 5:124366301-124366323 GTGAGTCAGAGAAAGGGGAAAGG - Intergenic
996629091 5:125606352-125606374 GTGAGTCAGTGGACTGGGAGAGG + Intergenic
996698744 5:126427259-126427281 GTGTGTCAAGGGTAGGGGTTTGG - Intronic
996757126 5:126946802-126946824 GTGTGTGTGGTGGAGGGGAGGGG + Intronic
997081096 5:130739393-130739415 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
997860187 5:137409002-137409024 GTGTGTTTGGGGAAGGGGTTTGG - Intronic
998044460 5:138975319-138975341 GCGTGTCAGGGGGAGGACAGTGG - Intronic
998176040 5:139902699-139902721 GTATGTAGGGGGAATGGGAGTGG + Intronic
998200220 5:140113294-140113316 GTGTGTGCGGGGAGGGGGAGCGG + Intronic
998251995 5:140559662-140559684 GTTAGCCAGGTGAAGGGGAGTGG - Intronic
998390451 5:141783984-141784006 GTGTGTCTGGGGGAAGGCAGGGG - Intergenic
998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG + Intergenic
999077012 5:148806034-148806056 GAGTGGGAGGGGAAGGGGTGTGG + Intergenic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
999205498 5:149845128-149845150 TGTTGTCAGAGGAAGGGGAGTGG + Intronic
999330785 5:150672155-150672177 GTGTTTCCTGGGATGGGGAGGGG + Intronic
999532914 5:152482004-152482026 GTGTGTGTGGGGCAGGGGAAGGG - Intergenic
999700806 5:154225982-154226004 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
999782273 5:154858834-154858856 GTCTGTAGGGGGAAGGGGAGTGG + Intronic
999939264 5:156522755-156522777 GTGTGTCGGGGGGTGGGGATGGG - Intronic
999991911 5:157057815-157057837 ATGGGGTAGGGGAAGGGGAGGGG - Intronic
1000130274 5:158290557-158290579 GTGTGTCCAGGGGAGGAGAGAGG + Intergenic
1000151794 5:158509634-158509656 GTGTGTTGGGGGACGGAGAGAGG + Intergenic
1000185263 5:158851933-158851955 GAGGGGCAGGGGAAGGGGAGGGG + Intronic
1001195875 5:169673125-169673147 GTGGGGCAGGTGGAGGGGAGTGG + Intronic
1001210781 5:169808312-169808334 GTGTGTTTGGGGAATGGGACAGG + Intronic
1001689685 5:173623820-173623842 GAGATTCAGGGGATGGGGAGAGG + Intergenic
1001792956 5:174476362-174476384 GTGGGGTAGGGGGAGGGGAGAGG - Intergenic
1001829385 5:174772995-174773017 GTGACTCAGGAGAAAGGGAGAGG + Intergenic
1001870363 5:175148961-175148983 GTGCAGCAGGGAAAGGGGAGGGG + Intergenic
1002194529 5:177494883-177494905 TGGGGTCAGGGGAGGGGGAGGGG + Intronic
1003059619 6:2853319-2853341 GAGGATCAGGGGAAGGGGTGGGG - Intergenic
1003059634 6:2853352-2853374 GAGGGTCAGGGATAGGGGAGGGG - Intergenic
1003059673 6:2853443-2853465 GAGGGTCAGGGAAAGGCGAGGGG - Intergenic
1003059682 6:2853475-2853497 GAGGGTCAGGGAAAGGGGAGGGG - Intergenic
1003059719 6:2853566-2853588 GAGGGTCAGGGAAAGGGGAGGGG - Intergenic
1003059733 6:2853598-2853620 GAGGGTCAGGGAAAGGGGAGGGG - Intergenic
1003059769 6:2853688-2853710 GAGGGTCAGGTAAAGGGGAGGGG - Intergenic
1003116118 6:3284819-3284841 TGGTGCCAGGGGAAGGGGCGGGG + Intronic
1003126217 6:3357963-3357985 GTGGGTGAGGGGAAGGGAAGAGG + Intronic
1003311395 6:4972504-4972526 GGTTGCCAGGGGACGGGGAGAGG + Intergenic
1003335851 6:5171502-5171524 GTGTGTTAGGGGAAGTGGTGGGG + Intronic
1003951624 6:11121562-11121584 GTGTGTGTTGGGAGGGGGAGAGG - Intronic
1004247721 6:13996232-13996254 GTCTGTCGGGGGACGGGGAGGGG - Intergenic
1004258132 6:14083872-14083894 GTGTGTCAGTGGAAGCAGAGTGG - Intergenic
1004675577 6:17838776-17838798 GTGAGGGAGTGGAAGGGGAGAGG + Intronic
1005123322 6:22415827-22415849 GGTTGTCAGGGGTTGGGGAGTGG - Intergenic
1005496338 6:26391339-26391361 GTCTGCCAGGGGAAGGGGTTTGG + Intronic
1005526243 6:26652878-26652900 ATGTGTCAGGGTAAAGAGAGTGG + Intronic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1005986882 6:30881233-30881255 GTGTGTTGGGAGGAGGGGAGCGG + Intronic
1006031590 6:31180390-31180412 ATGGCTCAGGGGAAGGGGAGAGG + Intronic
1006136212 6:31897613-31897635 GTGCGGAAGGGGAGGGGGAGAGG - Intronic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006404879 6:33839085-33839107 GCCTGTCTGGGGAAGAGGAGTGG - Intergenic
1006429904 6:33989038-33989060 GTGTCACAGGGGACGGGGACTGG - Intergenic
1006474306 6:34244962-34244984 GTGGGCCTGGGGAAGGGGTGGGG - Exonic
1006984281 6:38167000-38167022 GTGTGGCGGAGGAGGGGGAGGGG - Intergenic
1007199553 6:40095196-40095218 GTGAGTAAGGGGGATGGGAGGGG - Intergenic
1007247204 6:40471175-40471197 GAGTGTCTGGGAAAGGGGATGGG + Intronic
1007346048 6:41229971-41229993 AAGTGTGAGAGGAAGGGGAGAGG - Intronic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1007586045 6:42990057-42990079 GTGGGGCAGGGGATTGGGAGGGG + Intronic
1007702502 6:43773042-43773064 GGGTGTCATGGGAATGGGTGAGG + Intronic
1007816777 6:44530559-44530581 GGGTGCCTGGGGAAGGGGAGAGG + Intergenic
1008189418 6:48436595-48436617 GGCTGTCAGGGGATGGGGTGGGG - Intergenic
1008763889 6:54885816-54885838 GTGGGACAGGGGGAGGGGGGAGG + Intronic
1009043829 6:58213806-58213828 GTGGGGTGGGGGAAGGGGAGAGG + Intergenic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1010142032 6:72622742-72622764 GTGGGGCTGGGGGAGGGGAGAGG - Intronic
1010351773 6:74883426-74883448 GTGGGGCAGGGGGAGGGGGGAGG - Intergenic
1010354082 6:74909756-74909778 GTGGGGCAGGGGGAGGGGGGAGG + Intergenic
1010463284 6:76138041-76138063 GTGAGGTAGGGGAAGGGGGGAGG - Intergenic
1010633780 6:78231701-78231723 GTGGGGCAGGGGGAGGGGGGAGG - Intergenic
1010823962 6:80450475-80450497 GTGCTTCAGAGGAAGGGGATAGG + Intergenic
1010831783 6:80540230-80540252 TTGTGTCAGTGGACTGGGAGAGG - Intergenic
1011071525 6:83390839-83390861 GGGTGGCTGGGGAGGGGGAGAGG - Intronic
1011442047 6:87397869-87397891 GAGTGTGAGGGGAGAGGGAGTGG + Exonic
1011693196 6:89888141-89888163 GAGGGAGAGGGGAAGGGGAGGGG + Intergenic
1012533953 6:100272894-100272916 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
1012773125 6:103466378-103466400 GTGTGTTTGGGGAAGCAGAGGGG + Intergenic
1012946281 6:105469287-105469309 GTGTATCGGGGGAGGGTGAGGGG + Intergenic
1014061962 6:117082029-117082051 ATGGGGTAGGGGAAGGGGAGAGG + Intergenic
1014085370 6:117336321-117336343 GCCTGTCAGGGGGAGGGGTGGGG - Intronic
1014488295 6:122028959-122028981 GTGTGCCATGGGAAGGAGAGAGG + Intergenic
1015175039 6:130296930-130296952 AAGTGTCAGGGGAAGGGGCTGGG - Intronic
1015180091 6:130352062-130352084 GTGTGTTGGGGGGAGGGGGGAGG + Intronic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015675765 6:135746497-135746519 GTGGGTCGGGGGAAGGGGGAGGG + Intergenic
1015726353 6:136303402-136303424 TTGAGTCAGGGGACTGGGAGAGG + Intergenic
1015840650 6:137473409-137473431 GTGCCTCAGAGGGAGGGGAGGGG + Intergenic
1015847149 6:137532503-137532525 GTGTGGCGGGGGTAGGGTAGGGG + Intergenic
1015902381 6:138081388-138081410 CGGGGTCAGGGGAAGGGGGGAGG + Intergenic
1016003675 6:139067754-139067776 GAGGGGGAGGGGAAGGGGAGGGG - Intergenic
1016657603 6:146539811-146539833 TTGTGTCAGTGGACTGGGAGAGG - Intergenic
1016922516 6:149309840-149309862 GTGTGTCCTGGGAAGGGAAATGG - Intronic
1016998257 6:149976389-149976411 TTGAGTCGGGGGATGGGGAGAGG + Intergenic
1017356335 6:153513578-153513600 TTGAGTCAGTGGAATGGGAGAGG - Intergenic
1017511465 6:155118122-155118144 GGGTGTAAGGGGATGGGCAGGGG + Intronic
1017571118 6:155745440-155745462 ATGTGGTAGGGGGAGGGGAGTGG + Intergenic
1017623062 6:156318460-156318482 GGCTGTCAGGGGAAAGGAAGAGG - Intergenic
1018096684 6:160393431-160393453 GTGTGGTAGGGGGAGGGGGGAGG - Intronic
1018219838 6:161566780-161566802 GTGTGACTGGTGGAGGGGAGGGG - Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018399617 6:163409769-163409791 GTGTGTGTTGGGATGGGGAGTGG - Intergenic
1018428358 6:163703299-163703321 GTGTGTACTGAGAAGGGGAGGGG - Intergenic
1018715513 6:166529798-166529820 GTGTGTTTGGGGGCGGGGAGAGG - Intronic
1019117594 6:169777768-169777790 GTGGGTGGGGGGAAGGGGGGCGG - Intronic
1019415840 7:926216-926238 GTCTGGGAGGGGAACGGGAGGGG - Intronic
1019440174 7:1041952-1041974 ATGCGGCAGGGGAAGGGGAAGGG + Intronic
1019912438 7:4108836-4108858 GGTTGCCAGGGGATGGGGAGAGG - Intronic
1019953576 7:4393053-4393075 GGGTGCCAGGGGCTGGGGAGGGG + Intergenic
1020004018 7:4772163-4772185 GTGTGCCAGGGGCAGGGGGTTGG - Intronic
1020080227 7:5282811-5282833 GTGAGGAAGGGGGAGGGGAGGGG + Intronic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1020418147 7:7969233-7969255 GTGTGTAAGGGGGAGGGGCGGGG - Exonic
1020734919 7:11936255-11936277 GTGTGTGGGTGAAAGGGGAGGGG - Intergenic
1020800305 7:12724441-12724463 GGGTGTCAGGAATAGGGGAGAGG - Intergenic
1021771695 7:24009117-24009139 GCCTGTCAGGGGATGGGGGGTGG - Intergenic
1021835562 7:24669989-24670011 GTGAGGCAGGGGAAGAGAAGGGG - Intronic
1022755251 7:33280713-33280735 ATGTGTCAGGGGAAGAGCTGTGG + Intronic
1023650674 7:42365591-42365613 GCCTGTCAGGGGGTGGGGAGCGG - Intergenic
1023739809 7:43269352-43269374 GTGTGTCAGGGAAAGGGATCGGG - Intronic
1023983317 7:45081862-45081884 GCGAGTCTGGGGAAGGGGAGAGG + Exonic
1024221927 7:47295702-47295724 GTGTGAGAGTGGAAGGGGTGGGG - Intronic
1024249316 7:47494481-47494503 GTCTTTCAGGGGAGGTGGAGTGG - Intronic
1024492731 7:50004107-50004129 GTGAGTCAGGGGACCTGGAGAGG + Intronic
1024687614 7:51763983-51764005 ATGCTTCAGGGGAATGGGAGTGG - Intergenic
1026094063 7:67327484-67327506 GTTAGGGAGGGGAAGGGGAGAGG - Intergenic
1026678329 7:72446853-72446875 GGGTTTCCGAGGAAGGGGAGGGG - Intronic
1026913966 7:74108759-74108781 GTGTGGCAGAGGCAGGAGAGGGG + Intronic
1027276357 7:76561341-76561363 GTGGGGTAGGGGAAGGGGGGAGG - Intergenic
1027909244 7:84227917-84227939 GTGTGTCAGGGAGTGGGGGGCGG + Intronic
1027995853 7:85424388-85424410 GCGAGTCAGCGGTAGGGGAGGGG - Intergenic
1028369698 7:90076881-90076903 GTGAGGTAGGGGGAGGGGAGAGG + Intergenic
1028491590 7:91418478-91418500 GTGGGACAGGGGGAGGGGGGAGG - Intergenic
1028504546 7:91556873-91556895 GTGTGTCAAGGTGAGAGGAGGGG + Intergenic
1028614355 7:92748817-92748839 GTGTGGATGGGGAATGGGAGTGG - Intronic
1029110359 7:98210826-98210848 CTGTGTCAGGGGGAGGGTCGGGG + Intergenic
1029392165 7:100282565-100282587 GAGGGGGAGGGGAAGGGGAGGGG - Intergenic
1029409088 7:100397535-100397557 CAATGTCAAGGGAAGGGGAGGGG + Intronic
1029478163 7:100797466-100797488 GTGAGTCCTGGGAAGGAGAGAGG + Intronic
1030085476 7:105811887-105811909 GCCTGTGAGGGGAAGAGGAGAGG - Intronic
1030109405 7:106013671-106013693 CTGGGTGAGGGGAAGGGTAGCGG - Intronic
1031028803 7:116712687-116712709 GTGTGTGGGGGGGACGGGAGGGG - Intronic
1031382403 7:121103025-121103047 TTGTATCAGGGTAGGGGGAGCGG - Intronic
1031462834 7:122072810-122072832 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
1031638294 7:124129341-124129363 GTGTGTGGGGAGGAGGGGAGGGG - Intergenic
1031990839 7:128197896-128197918 GAGTGTCTGGGGACAGGGAGAGG - Intergenic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032284638 7:130531155-130531177 GTGGGGCAGGGCATGGGGAGAGG + Intronic
1032564916 7:132931816-132931838 GTGTGTCGGGGTAGGGGGAGGGG - Intronic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1032781285 7:135167028-135167050 GGGGGTCAGGGGAAGGAGTGGGG - Intronic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1033120802 7:138664974-138664996 GGGGGTCAGGGGAAAGGGCGGGG - Intronic
1033354943 7:140591989-140592011 GAGGGAGAGGGGAAGGGGAGGGG - Intronic
1033431949 7:141297498-141297520 GTGGGGTGGGGGAAGGGGAGAGG - Intronic
1033594532 7:142847783-142847805 TTGTGGCAGGAGAAGGGAAGGGG + Intergenic
1033658100 7:143386754-143386776 GTGTGGATGGGGAAGAGGAGAGG + Intronic
1033761056 7:144437184-144437206 GTTTATTTGGGGAAGGGGAGAGG + Intergenic
1033825684 7:145186941-145186963 GGGAGGGAGGGGAAGGGGAGGGG - Intergenic
1034396505 7:150829689-150829711 GTGAGTCTGGGGAAAGGGGGAGG - Intronic
1034412091 7:150947117-150947139 GTGGGGAAGGGGAAGGGGAGGGG + Intronic
1034422712 7:150997810-150997832 CAGTGACAGGGGCAGGGGAGTGG - Intronic
1034568969 7:151939867-151939889 AAGAGTCAGGGGAAGGGCAGGGG + Intergenic
1034622031 7:152463902-152463924 GTGAGTTAGGGGCAGGGGCGGGG + Intergenic
1034680656 7:152925369-152925391 GCGTCTCAGGGAGAGGGGAGAGG + Intergenic
1034894851 7:154869849-154869871 GTGTGTTGGGGGCAGGGGTGGGG - Intronic
1035224547 7:157426096-157426118 GGGTGCCAGGGGTTGGGGAGGGG + Intergenic
1035256101 7:157628720-157628742 GTGTGCCCGGGGATGGGGTGCGG + Intronic
1035407614 7:158609832-158609854 GTGTGTGAGGGGAGTGTGAGGGG + Intergenic
1035600150 8:892526-892548 GGGTGCCAGGGGCTGGGGAGGGG + Intergenic
1035606157 8:930938-930960 GGGAGGCAGGGGAAGGGCAGAGG + Intergenic
1035644754 8:1210456-1210478 GTGTGTGGGGGGAAGGAGAGGGG + Intergenic
1035676949 8:1462687-1462709 GGGTGGCTGGGGAAGGGGAAGGG + Intergenic
1036638205 8:10565609-10565631 GTGTGTCGGGGGCAGGTGGGAGG - Intergenic
1036651605 8:10647499-10647521 GGCTGTCAGGGGCTGGGGAGAGG - Intronic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1037467256 8:19172633-19172655 GAGGGGGAGGGGAAGGGGAGAGG + Intergenic
1037849014 8:22310718-22310740 GTGTGTGAGGGGTAAGGGATAGG - Intronic
1037961099 8:23098923-23098945 GTGGGTGGGGAGAAGGGGAGAGG + Intronic
1038189124 8:25302891-25302913 GAGTGTCAGGGGCTGGAGAGGGG + Intronic
1038746645 8:30260709-30260731 ATGTGTCAGGGCAAGAGGGGTGG + Intergenic
1039290148 8:36085888-36085910 GTGTGGCAGGGGAAGGGAACAGG + Intergenic
1039823592 8:41154873-41154895 GTTTAGCAGGGGAAGGAGAGAGG + Intergenic
1039911101 8:41827967-41827989 GTGTGTCGGGGGTTGGGGGGCGG - Intronic
1040085453 8:43335374-43335396 GTGTTTGAGGGGAAGGGTGGTGG - Intergenic
1040112117 8:43571202-43571224 GTCTTCCAGGGGAAGGGGACAGG - Intergenic
1040466903 8:47703869-47703891 GTGTGTCAGGGAGAGGAGACGGG + Intronic
1040853181 8:51923205-51923227 AAGTCTTAGGGGAAGGGGAGGGG - Intergenic
1040969397 8:53117260-53117282 GTGGGGTAGGGGGAGGGGAGAGG - Intergenic
1041094996 8:54341351-54341373 GTGGCTCAGGGGAGGGTGAGGGG + Intergenic
1041231531 8:55757653-55757675 GAGTGTGTGGGGCAGGGGAGTGG - Intronic
1041474341 8:58247419-58247441 GTGTGTCAGGGGGGGCGGGGTGG - Intergenic
1041485940 8:58376019-58376041 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
1041588400 8:59547372-59547394 GTGGGGCAGGGGAGGGGGAGGGG - Intergenic
1041617737 8:59928007-59928029 TTGTGTGAGGGGTAGGTGAGTGG + Intergenic
1041889178 8:62849591-62849613 GTGGGTGGGGGGGAGGGGAGAGG - Intronic
1041925347 8:63230436-63230458 TTGAGTCAGGGGACTGGGAGAGG + Intergenic
1042101479 8:65279826-65279848 TTGAGTCAGGGGACTGGGAGAGG - Intergenic
1042139504 8:65663754-65663776 GAGGGGAAGGGGAAGGGGAGGGG - Intronic
1042404518 8:68388549-68388571 GTGTGTGAGTTGAAGGGGTGGGG - Intronic
1042725339 8:71868918-71868940 GTGGGGCAGGGGGAGTGGAGAGG + Intronic
1042764865 8:72309867-72309889 GCCTGTCAGGGGAATGGGGGTGG - Intergenic
1042817925 8:72898291-72898313 GTGGGGTAGGGGAAGGGGGGAGG + Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043147873 8:76679034-76679056 GTGTGCATGGGGAAGGGGAGTGG - Intergenic
1043314431 8:78902405-78902427 GGGTGTCAGGGAGAGGGTAGGGG - Intergenic
1043697426 8:83237809-83237831 GCCTGTCAGGGAATGGGGAGTGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1043908372 8:85833177-85833199 GAGGGGCAAGGGAAGGGGAGGGG - Intergenic
1044112886 8:88298244-88298266 GGGTGTTTGGGGAAGGGAAGTGG - Intronic
1044251441 8:90007498-90007520 ATGTATCAGGTGAAGAGGAGAGG + Intronic
1044519111 8:93177244-93177266 GTGAGTGGGGGGAAGGGGTGAGG + Intergenic
1044620732 8:94188442-94188464 CTGGTTCAGGGGACGGGGAGGGG + Intronic
1044727932 8:95208176-95208198 GTGTGTGTGGGGGAGGGGGGGGG + Intergenic
1045231868 8:100313512-100313534 GTGGGCCAGGGGACGGGGGGTGG + Intronic
1045291170 8:100834074-100834096 GTGAGTCAGTGGACTGGGAGAGG - Intergenic
1045789721 8:105968338-105968360 GTGGGGCAGGGGGAGGGGGGAGG + Intergenic
1045950723 8:107848936-107848958 GGGAGGAAGGGGAAGGGGAGGGG + Intergenic
1046015617 8:108601156-108601178 GAGGGGGAGGGGAAGGGGAGGGG + Intergenic
1046195395 8:110857544-110857566 CTTTGGCAGGGCAAGGGGAGTGG + Intergenic
1046195992 8:110863083-110863105 GTGTGTATGTGGATGGGGAGGGG - Intergenic
1046303956 8:112337280-112337302 ATGTGTGTGGGGAAGGGAAGGGG - Intronic
1046306915 8:112379955-112379977 GGTTGTCAGGGGATAGGGAGAGG + Intronic
1046596942 8:116272431-116272453 CTTTGTCAGGGCAAGGGAAGTGG + Intergenic
1046847249 8:118931536-118931558 GTGTGTCAGGGTGCGGGGTGTGG - Intronic
1046885192 8:119359059-119359081 ATGTGGAAGGAGAAGGGGAGGGG + Intergenic
1046890355 8:119415847-119415869 GTGTGTTGGGGGGAGGGGAGTGG - Intergenic
1047071146 8:121344842-121344864 GTGTGTTGGGGTGAGGGGAGTGG - Intergenic
1047304406 8:123641233-123641255 GTGGGTCAGGGGAAAGAAAGAGG + Intergenic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1047761159 8:127955593-127955615 GACTGTCTCGGGAAGGGGAGGGG - Intergenic
1047818317 8:128489549-128489571 GTATTTCAGGGGATGGGCAGAGG - Intergenic
1048194614 8:132322034-132322056 GTGTGGCAGAAGAAGGAGAGCGG + Intronic
1049701553 8:144016481-144016503 GTGTGACAGGGGCCAGGGAGAGG + Intronic
1049837321 8:144745069-144745091 GAGCGGGAGGGGAAGGGGAGCGG + Intronic
1050428578 9:5537728-5537750 GTGTGGTCGGGGGAGGGGAGAGG + Intronic
1050620018 9:7442541-7442563 GTGTGTCAGGGCGGGGGGGGGGG - Intergenic
1050648984 9:7754857-7754879 GTCTGCCAGGGGATGGGGCGTGG + Intergenic
1050823425 9:9913516-9913538 GTGTCGAAGGGAAAGGGGAGTGG + Intronic
1051334935 9:16057675-16057697 GTGTGGCAGAGGGAGGGAAGCGG - Intronic
1051864304 9:21662217-21662239 GTGGGGTAGGGGGAGGGGAGAGG - Intergenic
1052078251 9:24171944-24171966 GTGTGGCAGGGGGAGGGGAGTGG + Intergenic
1052247103 9:26349092-26349114 TAGTTTCAGGGGAAGGGGAAGGG - Intergenic
1052287722 9:26805839-26805861 GTGTGTCAGGGGACGAGGACTGG - Intergenic
1052759920 9:32579532-32579554 GCTGGTCAGGGGACGGGGAGGGG + Intergenic
1052851630 9:33381706-33381728 GGGCGCCAGGGGGAGGGGAGGGG - Intergenic
1052883255 9:33618661-33618683 GTGGGGCAGGGGATGGGTAGGGG + Intergenic
1053259175 9:36646760-36646782 GAGGGTCAGAGGAAGGGTAGGGG + Intronic
1053719778 9:40933764-40933786 GTGGGTTGGGGGAAGGGGACAGG + Intergenic
1054356831 9:64070602-64070624 GTGTGTGCGGGTAGGGGGAGTGG - Intergenic
1054929039 9:70617390-70617412 GGGTGTCAGGGGCAGGGGTGAGG + Intronic
1055202941 9:73689747-73689769 GTGTGTTTGGGGGAGGGGAAAGG + Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1055878069 9:80966972-80966994 TTGAGTCAGTGGAATGGGAGAGG + Intergenic
1056292428 9:85157153-85157175 GTGGGTCTGGGGTGGGGGAGTGG + Intergenic
1056442413 9:86634108-86634130 GTGTGTGAGAAGAAGGGGTGTGG + Intergenic
1056488837 9:87085343-87085365 GGGCGCCAGGGGAGGGGGAGGGG - Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056614677 9:88153676-88153698 GTGGGTTGGGGGTAGGGGAGAGG + Intergenic
1056729222 9:89150355-89150377 GTGTGGGAGAGGATGGGGAGTGG - Intronic
1057031171 9:91776263-91776285 GTGGGTCTGGGGATGGGGAGGGG - Intronic
1057217009 9:93234686-93234708 GTGTGCCATGGGATGTGGAGGGG + Intronic
1057229057 9:93308014-93308036 GTGAGTCTGGGGATGGGCAGCGG + Intronic
1057501457 9:95599931-95599953 GTGTGTCGGGGGGGGGGCAGGGG + Intergenic
1057837162 9:98454760-98454782 GGGTGGGAAGGGAAGGGGAGGGG - Intronic
1057844678 9:98514253-98514275 GTGGGGTAGGGGGAGGGGAGAGG + Intronic
1058139429 9:101342358-101342380 GAGTTTGAGGGGAGGGGGAGAGG + Intergenic
1059165404 9:112072511-112072533 GTGTGTTGGGAGAGGGGGAGGGG - Intronic
1059506501 9:114804067-114804089 GTGTGTCAGAAGAAAAGGAGAGG - Intronic
1059760102 9:117329556-117329578 GGGTTTTAGAGGAAGGGGAGAGG + Intronic
1059842035 9:118228420-118228442 GTGTGTGAGGGGACAGGGAATGG - Intergenic
1059921528 9:119165917-119165939 CTGTGTGTGGGGAACGGGAGTGG + Intronic
1059940424 9:119353969-119353991 GTGGGTCAAGGGAGAGGGAGGGG - Intronic
1060158638 9:121338935-121338957 GTGGGCCAGGGGAAGGGGACAGG - Intergenic
1060187856 9:121574863-121574885 GAGTCTCAGGGCAAGGGGAGGGG - Intronic
1060213444 9:121724286-121724308 GTGGGGCAGGGAACGGGGAGGGG - Intronic
1060550195 9:124481340-124481362 ATGTTTCAGGGGGCGGGGAGGGG + Exonic
1060573823 9:124670055-124670077 TTATGTGAGGGGAAGGGTAGGGG - Intronic
1061043155 9:128151143-128151165 GGGTGCCAGGGGATGGGAAGTGG + Intronic
1061091246 9:128427853-128427875 GGGTGTGAGGTGAAGTGGAGGGG + Intronic
1061160319 9:128890164-128890186 GTGTGTGCTGGGAAGGCGAGGGG + Intronic
1061165515 9:128919936-128919958 GTGGGGGAGGGGGAGGGGAGAGG - Intergenic
1061248398 9:129413307-129413329 GGGTGGCGGGGGAAGGGGCGAGG + Intergenic
1061471630 9:130831339-130831361 GTGTGTCAAGGGAAGGAGGCAGG - Intronic
1061489869 9:130938976-130938998 GTGTGTCGGGGGAGGCCGAGGGG - Intronic
1061656619 9:132096611-132096633 TTGAGTCAGTGGAATGGGAGAGG - Intergenic
1061661628 9:132134055-132134077 GTGTGTTAGTGGGAGGGAAGAGG - Intergenic
1062105709 9:134753761-134753783 GGGTGGCAGGGGAGGGGCAGGGG - Intronic
1062153790 9:135034696-135034718 GGGTGCCAGGGGCTGGGGAGAGG - Intergenic
1062252565 9:135605620-135605642 GTGTGGCAGGGGAGGGTGATTGG + Intergenic
1062267650 9:135694732-135694754 GTGTGGGAGGGGGAGGGGAGGGG - Intronic
1062314703 9:135960990-135961012 GGGTGTTGGGGGCAGGGGAGGGG + Intronic
1203473031 Un_GL000220v1:125169-125191 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1185472811 X:394863-394885 GGTTGCCAGGGGATGGGGAGGGG - Intergenic
1185630850 X:1514860-1514882 GGAAGACAGGGGAAGGGGAGGGG - Intronic
1185656339 X:1688691-1688713 CTGTCTCGGGGGGAGGGGAGGGG + Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186188037 X:7040840-7040862 GGGTGTCAAGAGATGGGGAGAGG - Intergenic
1186393629 X:9185860-9185882 TGGTGTCTGGGGAAGGGCAGGGG - Intergenic
1186789569 X:12983769-12983791 GTGGGTCTGTGGAAGGAGAGAGG + Intergenic
1187141285 X:16596333-16596355 GTGGGTTAGGGGGAGGGGGGAGG - Intronic
1187188492 X:17010604-17010626 TTGTGTAAGGGGGAGGGAAGAGG + Intronic
1187429723 X:19211181-19211203 TGGTGTCAGGGCAGGGGGAGGGG - Intergenic
1187435429 X:19264158-19264180 GTGGGTGAGGGGAATGGGAGTGG - Intergenic
1187934195 X:24320019-24320041 GTTTGTCAGGGGTTAGGGAGAGG - Intergenic
1188734594 X:33696748-33696770 GGGTGCAAGGGGAAGGGGAGGGG + Intergenic
1189237354 X:39497566-39497588 GTATGTCAGAGTTAGGGGAGAGG + Intergenic
1189331223 X:40146089-40146111 GTGTGCTAGGGGAAGAGGAAGGG - Intronic
1189363416 X:40370422-40370444 CTGGGGCAGGGGACGGGGAGAGG - Intergenic
1189534678 X:41923752-41923774 GTGGCCCAGGGAAAGGGGAGCGG + Intergenic
1189564133 X:42222256-42222278 GTGAGTAGGGGGAAGGGGACAGG - Intergenic
1189854017 X:45205099-45205121 GGGTGTCGGGGGAGGGGAAGTGG - Intergenic
1190101080 X:47523675-47523697 GGGAGGCAGGGGAAGGGGGGCGG - Intergenic
1190367407 X:49709348-49709370 GTGGGGGAGGGGGAGGGGAGGGG + Intergenic
1190446169 X:50526483-50526505 GTGGGGTAGGGGGAGGGGAGAGG + Intergenic
1190965578 X:55297796-55297818 GTGGGTTGAGGGAAGGGGAGAGG - Intergenic
1191002981 X:55681296-55681318 GTGGGGTGGGGGAAGGGGAGAGG - Intergenic
1191060077 X:56285840-56285862 TGGGGTCAGGGGTAGGGGAGGGG + Intronic
1191086113 X:56569033-56569055 GTGTGGGAGGGGAGGGGCAGGGG + Intergenic
1191699165 X:64020960-64020982 GTGTGTCAGGGGATATGTAGAGG - Intergenic
1191872193 X:65757026-65757048 GGGTGTCAGGGGTTAGGGAGAGG - Intergenic
1191879004 X:65825646-65825668 GTGGGTGGGGGGAGGGGGAGAGG + Intergenic
1192180761 X:68914357-68914379 ATGTGTGTGGGGGAGGGGAGCGG - Intergenic
1192233423 X:69281251-69281273 GTGTGTAAGGGGTGGGAGAGAGG + Intergenic
1192244574 X:69361838-69361860 GAGGAGCAGGGGAAGGGGAGGGG + Intergenic
1193326786 X:80187686-80187708 GTGGGGTAGGGGAAGGGGGGAGG - Intergenic
1193331456 X:80239336-80239358 GTGTGTGTGTGGTAGGGGAGGGG + Intergenic
1193427314 X:81355254-81355276 GAGGCTCAGGGGAGGGGGAGAGG + Intergenic
1193472923 X:81928463-81928485 TTGAGTCAGGGGACTGGGAGAGG - Intergenic
1193850875 X:86536070-86536092 TAGTTTCAGGGGAAGGGGAAGGG + Intronic
1193926318 X:87489721-87489743 GTGTGTCTGGGGGTGGGGTGGGG + Intergenic
1194023331 X:88721266-88721288 TTGTGTCAGAGGACTGGGAGAGG - Intergenic
1194838981 X:98715338-98715360 GCCTGTCTGGTGAAGGGGAGGGG + Intergenic
1194933471 X:99917917-99917939 GTGAGTCAGTGGACTGGGAGAGG + Intergenic
1195276760 X:103288486-103288508 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1195365118 X:104117309-104117331 GTGGCTCCAGGGAAGGGGAGTGG - Intronic
1195516177 X:105778804-105778826 ATGTGTATGGGGGAGGGGAGTGG - Intergenic
1195552967 X:106189372-106189394 GTGTGGTGGGGGGAGGGGAGAGG - Intronic
1195589808 X:106611766-106611788 GGATGACAGGGGAAGGGGAGGGG - Intergenic
1195845539 X:109223591-109223613 GTGTGTCAAAGGAAGCTGAGTGG + Intergenic
1195899561 X:109783235-109783257 GTGTGTGCGGGGCAGGGAAGAGG - Intergenic
1195949911 X:110259163-110259185 GTGTGTCAGGGGAGTTTGAGGGG - Intronic
1196016730 X:110947517-110947539 GTGTGTGTGTGGATGGGGAGAGG - Intronic
1196243143 X:113366770-113366792 TGCTGCCAGGGGAAGGGGAGAGG + Intergenic
1196739275 X:119010179-119010201 ATGTGAGAGGTGAAGGGGAGGGG + Intronic
1196797790 X:119516016-119516038 GGGAGTTAGGGGAGGGGGAGAGG + Intergenic
1197096559 X:122603824-122603846 GTGTGGTGGGGGAGGGGGAGGGG - Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1197872427 X:131072638-131072660 GTGTGGCATGGCCAGGGGAGGGG + Intronic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198395104 X:136212385-136212407 CTGGCTCAGGGGATGGGGAGTGG + Intergenic
1198410606 X:136363253-136363275 GTGGGAAGGGGGAAGGGGAGTGG - Intronic
1198771907 X:140139209-140139231 GTGTGTCAGGGGGTGCTGAGAGG + Intergenic
1198903628 X:141537313-141537335 GCCTGTCAGGGGGTGGGGAGAGG - Intergenic
1199013646 X:142786252-142786274 GTGGGGCAGGGGGAGGGGGGAGG - Intergenic
1200052133 X:153439500-153439522 GTGTGTCAGGGGAGTGTGTGTGG + Intergenic
1200298288 X:154945018-154945040 GTGGGGTGGGGGAAGGGGAGAGG + Intronic
1200829113 Y:7673377-7673399 GGGTGGCAGGGGGAGGGCAGCGG - Intergenic
1201403017 Y:13623505-13623527 GTGTGGCTGGGGAAGGGGGGAGG - Intergenic
1202021122 Y:20466210-20466232 TTGTGACATGGGAAGAGGAGAGG + Intergenic
1202301967 Y:23426124-23426146 GTTTGTCACGGGGAGGGGAAGGG - Intergenic
1202568844 Y:26244474-26244496 GTTTGTCACGGGGAGGGGAAGGG + Intergenic